Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MntR in Lactobacillus rhamnosus GG

Properties
Regulator type: Transcription factor
TF locus tag: LGG_00759
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Lactobacillaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -31
Score: 5.6
Sequence: GAATTAGGTCACCCTAAAAT
Locus tag: LGG_02421
Name: mntC
Funciton: Manganese ABC transporter, permease protein
Locus tag: LGG_02420
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: LGG_02419
Name: mntA
Funciton: Manganese ABC transporter, substrate-binding protein
mntC
Manganese ABC transporter, permease protein
mntB
Manganese ABC transporter, ATP-binding protein
mntA
Manganese ABC transporter, substrate-binding protein

Position: -72
Score: 6.4
Sequence: AAGTTAGGGAGACCTAAAAG
Locus tag: LGG_02411
Name: mntH
Funciton: Manganese transport protein MntH
mntH
Manganese transport protein MntH
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD