Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MntR in Lactobacillus brevis ATCC 367

Properties
Regulator type: Transcription factor
TF locus tag: LVIS_1718
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -19
Score: 5
Sequence: AAGGAAGGGAGTCTTAAAAT
Locus tag: LVIS_0225
Name: mntH
Funciton: Manganese transport protein MntH
mntH
Manganese transport protein MntH

Position: -213
Score: 4.3
Sequence: ATTTTTGGTAAGCCAAAAAT
Locus tag: LVIS_0331
Name: mntH
Funciton: Manganese transport protein MntH
mntH
Manganese transport protein MntH
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD