Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PadR in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type: Transcription factor
TF locus tag: PEPE_0492
Regulator family: PadR
Regulation mode: repressor
Biological process: Phenolic acid stress response
Effector: p-Coumaric acid; Ferulic acid
Regulog: PadR - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: 7
Score: 6.4
Sequence: AAACTTTTAAAACTTTAGATGACT
Locus tag: PEPE_0491
Name: padC
Funciton: Phenolic acid decarboxylase (EC 4.1.1.-)
Locus tag: PEPE_0492
Name: padR
Funciton: Phenolic acid stress response transcriptional regulator PadR, PadR family
padC
Phenolic acid decarboxylase (EC 4.1.1.-)
padR
Phenolic acid stress response transcriptional regulator PadR, PadR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD