Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PadR in Lactobacillus brevis ATCC 367

Properties
Regulator type: Transcription factor
TF locus tag: LVIS_0214
Regulator family: PadR
Regulation mode: repressor
Biological process: Phenolic acid stress response
Effector: p-Coumaric acid; Ferulic acid
Regulog: PadR - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -208
Score: 7.1
Sequence: GAACATGTAATTAATTACATGTTT
Locus tag: LVIS_0214
Name: padR
Funciton: Phenolic acid stress response transcriptional regulator PadR, PadR family
padR
Phenolic acid stress response transcriptional regulator PadR, PadR family

Position: -48
Score: 7.1
Sequence: AAACATGTAATTAATTACATGTTC
Locus tag: LVIS_0213
Name: padC
Funciton: Phenolic acid decarboxylase (EC 4.1.1.-)
padC
Phenolic acid decarboxylase (EC 4.1.1.-)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD