Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NrtR in Lactobacillus casei ATCC 334

Properties
Regulator type: Transcription factor
TF locus tag: LSEI_2768
Regulator family: NrtR
Regulation mode:
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -40
Score: 6.3
Sequence: TTTAAGTAAAAAATACTTTTA
Locus tag: LSEI_2767
Name: pncA
Funciton: Nicotinamidase (EC 3.5.1.19)
Locus tag: LSEI_2766
Name: pncB
Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
pncA
Nicotinamidase (EC 3.5.1.19)
pncB
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD