Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR in Lactobacillus plantarum WCFS1

Properties
Regulator type: Transcription factor
TF locus tag: lp_0172
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR - Lactobacillaceae
Statistics of regulated genes:
- Genes 10
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -86
Score: 6
Sequence: TTACGAAAACGCTTGCGAAA
Position: -74
Score: 4.9
Sequence: TTGCGAAAGCGTTTGCACAG
Locus tag: lp_0175
Name: malX
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: lp_0176
Name: malC
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: lp_0177
Name: malD
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: lp_0178
Name: malA
Funciton: Maltodextrose utilization protein MalA
malX
Maltose/maltodextrin ABC transporter, substrate-binding protein
malC
Maltose/maltodextrin ABC transporter, permease protein 1
malD
Maltose/maltodextrin ABC transporter, permease protein 2
malA
Maltodextrose utilization protein MalA

Position: -77
Score: 6.2
Sequence: TTATGCAATCGCTTGCAATA
Locus tag: lp_0172
Name: malR
Funciton: Maltose utilization transcriptional regulator MalR, LacI family
Locus tag: lp_0173
Name: mdxR
Funciton: Maltose/maltodextrin utilization transcriptional repressor MdxR, LacI family
Locus tag: lp_0174
Name: agl1
Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10)
malR
Maltose utilization transcriptional regulator MalR, LacI family
mdxR
Maltose/maltodextrin utilization transcriptional repressor MdxR, LacI family
agl1
Oligo-1,6-glucosidase (EC 3.2.1.10)

Position: -87
Score: 6.3
Sequence: TCACGCAAACGCTTGCATAA
Locus tag: lp_1729
Name: malT
Funciton: Predicted maltose/maltodextrin permease
Locus tag: lp_1730
Name: mapA
Funciton: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
Locus tag: lp_1731
Name: galM
Funciton: Aldose 1-epimerase
malT
Predicted maltose/maltodextrin permease
mapA
Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
galM
Aldose 1-epimerase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD