Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR in Lactobacillus brevis ATCC 367

Properties
Regulator type: Transcription factor
TF locus tag: LVIS_0356
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -93
Score: 6.2
Sequence: TTGCGCAATCGGTTGCATTA
Locus tag: LVIS_0357
Name: malT
Funciton: Predicted maltose/maltodextrin permease
Locus tag: LVIS_0358
Name: mapA
Funciton: Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
malT
Predicted maltose/maltodextrin permease
mapA
Maltose phosphorylase (EC 2.4.1.8) / Trehalose phosphorylase (EC 2.4.1.64)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD