Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CopR in Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Properties
Regulator type: Transcription factor
TF locus tag: LEUM_0049
Regulator family: CopY
Regulation mode: repressor
Biological process: Copper homeostasis
Effector: Copper ion, (Cu2+)
Regulog: CopR - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -25
Score: 5.9
Sequence: TAGTTTACAGTTGTAGACTA
Locus tag: LEUM_0049
Name: copR
Funciton: Copper transport transcriptional regulator CopR, CopY family
Locus tag: LEUM_0048
Name: copB
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
copR
Copper transport transcriptional regulator CopR, CopY family
copB
Copper-translocating P-type ATPase (EC 3.6.3.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD