Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CopR in Lactobacillus reuteri JCM 1112

Properties
Regulator type: Transcription factor
TF locus tag: LAR_0894
Regulator family: CopY
Regulation mode: repressor
Biological process: Copper homeostasis
Effector: Copper ion, (Cu2+)
Regulog: CopR - Lactobacillaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -32
Score: 5.1
Sequence: GAATTTACATGTGTAAACGC
Locus tag: LAR_0894
Name: copR
Funciton: Copper transport transcriptional regulator CopR, CopY family
copR
Copper transport transcriptional regulator CopR, CopY family

Position: -70
Score: 4.6
Sequence: TTGTTGACAACTGTAAACTT
Position: -27
Score: 6.4
Sequence: ATGATTACAATTGTAAACTA
Locus tag: LAR_0423
Name: copA2
Funciton: Copper-exporting ATPase (EC 3.6.3.4)
Locus tag: LAR_0424
Name: copA3
Funciton: Copper-exporting ATPase (EC 3.6.3.4)
Locus tag: LAR_0425
Name: copA
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
copA2
Copper-exporting ATPase (EC 3.6.3.4)
copA3
Copper-exporting ATPase (EC 3.6.3.4)
copA
Copper-translocating P-type ATPase (EC 3.6.3.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD