Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CopR in Lactobacillus casei ATCC 334

Properties
Regulator type: Transcription factor
TF locus tag: LSEI_1745, LSEI_A02
Regulator family: CopY
Regulation mode: repressor
Biological process: Copper homeostasis
Effector: Copper ion, (Cu2+)
Regulog: CopR - Lactobacillaceae
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -77
Score: 5.4
Sequence: GTGACTACAGTTGTAAACTA
Position: -46
Score: 4.6
Sequence: GAGACTACAAACGTAAACTT
Locus tag: LSEI_A02
Name: copR
Funciton: Copper transport transcriptional regulator CopR, CopY family
Locus tag: LSEI_A01
Name: copB
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
copR
Copper transport transcriptional regulator CopR, CopY family
copB
Copper-translocating P-type ATPase (EC 3.6.3.4)

Position: -59
Score: 5
Sequence: TGGTTTACAGTTGTAAATTA
Position: -29
Score: 6.1
Sequence: TAGATTACAGATGTAAACGG
Locus tag: LSEI_1745
Name: copR
Funciton: Copper transport transcriptional regulator CopR, CopY family
Locus tag: LSEI_1744
Name: LSEI_1744
Funciton: Hypothetical protein
Locus tag: LSEI_1743
Name: copB
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
copR
Copper transport transcriptional regulator CopR, CopY family
LSEI_1744
Hypothetical protein
copB
Copper-translocating P-type ATPase (EC 3.6.3.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD