Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CopR in Lactobacillus brevis ATCC 367

Properties
Regulator type: Transcription factor
TF locus tag: LVIS_0270
Regulator family: CopY
Regulation mode: repressor
Biological process: Copper homeostasis
Effector: Copper ion, (Cu2+)
Regulog: CopR - Lactobacillaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -184
Score: 5.1
Sequence: TCGTTGACAGATGTAAACGA
Position: -139
Score: 5.7
Sequence: AGGATTACATTTGTAAACAA
Locus tag: LVIS_0274
Name: copA2
Funciton: Copper-exporting ATPase (EC 3.6.3.4)
Locus tag: LVIS_0273
Name: copA
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
copA2
Copper-exporting ATPase (EC 3.6.3.4)
copA
Copper-translocating P-type ATPase (EC 3.6.3.4)

Position: -68
Score: 5.4
Sequence: ATGACTACAGATGTAGACTC
Position: -35
Score: 6
Sequence: AAGATTACATTTGTAGTCTA
Locus tag: LVIS_0270
Name: copR
Funciton: Copper transport transcriptional regulator CopR, CopY family
Locus tag: LVIS_0269
Name: copB
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
copR
Copper transport transcriptional regulator CopR, CopY family
copB
Copper-translocating P-type ATPase (EC 3.6.3.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD