Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of XylR in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type: Transcription factor
TF locus tag: PEPE_0186
Regulator family: ROK
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose
Regulog: XylR - Lactobacillaceae
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -66
Score: 5.1
Sequence: GTTTGTAAATAGAACTAACAAAC
Locus tag: PEPE_0185
Name: xynT
Funciton: Xyloside transporter XynT
Locus tag: PEPE_0186
Name: xylR
Funciton: Xylose repressor XylR, ROK family
Locus tag: PEPE_0187
Name: xylA
Funciton: Xylose isomerase (EC 5.3.1.5)
Locus tag: PEPE_0188
Name: xylB
Funciton: Xylulose kinase (EC 2.7.1.17)
xynT
Xyloside transporter XynT
xylR
Xylose repressor XylR, ROK family
xylA
Xylose isomerase (EC 5.3.1.5)
xylB
Xylulose kinase (EC 2.7.1.17)

Position: -182
Score: 5.1
Sequence: GTTTGTTAGTTCTATTTACAAAC
Locus tag: PEPE_0184
Name: xylS
Funciton: Alpha-xylosidase (EC 3.2.1.-)
xylS
Alpha-xylosidase (EC 3.2.1.-)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD