Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of XylR in Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Properties
Regulator type: Transcription factor
TF locus tag: LEUM_0129
Regulator family: ROK
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose
Regulog: XylR - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -59
Score: 5.8
Sequence: GTTGGTTGGTGTAACCAACTATG
Locus tag: LEUM_0130
Name: xylA
Funciton: Xylose isomerase (EC 5.3.1.5)
Locus tag: LEUM_0131
Name: xylB
Funciton: Xylulose kinase (EC 2.7.1.17)
xylA
Xylose isomerase (EC 5.3.1.5)
xylB
Xylulose kinase (EC 2.7.1.17)

Position: -87
Score: 5.6
Sequence: GTTAGTTGGTTGCGTAAATAAAC
Position: -83
Score: 5.7
Sequence: GTTGGTTGCGTAAATAAACTAAC
Locus tag: LEUM_0128
Name: xylT
Funciton: D-xylose proton-symporter XylT
xylT
D-xylose proton-symporter XylT
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD