Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of XylR in Lactobacillus fermentum IFO 3956

Properties
Regulator type: Transcription factor
TF locus tag: LAF_0400
Regulator family: ROK
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose
Regulog: XylR - Lactobacillaceae
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -53
Score: 5.1
Sequence: GTTAGTTGTTTTAAAAAACCAAT
Locus tag: LAF_0402
Name: xylA
Funciton: Xylose isomerase (EC 5.3.1.5)
Locus tag: LAF_0403
Name: xylB
Funciton: Xylulose kinase (EC 2.7.1.17)
xylA
Xylose isomerase (EC 5.3.1.5)
xylB
Xylulose kinase (EC 2.7.1.17)

Position: -121
Score: 5.5
Sequence: GTTTGTTTACTAAATAAACTAAC
Locus tag: LAF_0405
Name: xynB2
Funciton: Beta-xylosidase (EC 3.2.1.37)
Locus tag: LAF_0406
Name: xynT3
Funciton: Xyloside transporter XynT
xynB2
Beta-xylosidase (EC 3.2.1.37)
xynT3
Xyloside transporter XynT

Position: -90
Score: 5.2
Sequence: GTTAGTTTTTATCAGCAACTAAC
Locus tag: LAF_0401
Name: xylT
Funciton: D-xylose proton-symporter XylT
xylT
D-xylose proton-symporter XylT
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD