Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of XylR in Lactobacillus brevis ATCC 367

Properties
Regulator type: Transcription factor
TF locus tag: LVIS_0464, LVIS_2109
Regulator family: ROK
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose
Regulog: XylR - Lactobacillaceae
Statistics of regulated genes:
- Genes 11
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -42
Score: 5.7
Sequence: GTTGGTTGTCGCAACGAACTAAC
Locus tag: LVIS_0183
Name: xylA
Funciton: Xylose isomerase (EC 5.3.1.5)
Locus tag: LVIS_0184
Name: xylB
Funciton: Xylulose kinase (EC 2.7.1.17)
xylA
Xylose isomerase (EC 5.3.1.5)
xylB
Xylulose kinase (EC 2.7.1.17)

Position: -151
Score: 5.3
Sequence: GTAAATTGGTTTACTAAACCAAC
Locus tag: LVIS_0463
Name: xynT
Funciton: Xyloside transporter XynT
Locus tag: LVIS_0464
Name: xylR
Funciton: Xylose repressor XylR, ROK family
xynT
Xyloside transporter XynT
xylR
Xylose repressor XylR, ROK family

Position: -154
Score: 5.4
Sequence: GTTGGTTGGTTCACTGAACCATG
Locus tag: LVIS_2109
Name: xylR
Funciton: Xylose repressor XylR, ROK family
xylR
Xylose repressor XylR, ROK family

Position: -90
Score: 5.1
Sequence: GTTGGTTGCTTTCGACAACTAAT
Locus tag: LVIS_2287
Name: null
Funciton: AraC-type DNA-binding protein
Locus tag: LVIS_2286
Name: xynT2
Funciton: Xyloside transporter XynT
Locus tag: LVIS_2285
Name: xynB
Funciton: Beta-xylosidase
AraC-type DNA-binding protein
xynT2
Xyloside transporter XynT
xynB
Beta-xylosidase

Position: -150
Score: 5.3
Sequence: GTTGGTTTAGTAAACCAATTTAC
Locus tag: LVIS_0462
Name: xylS
Funciton: Alpha-xylosidase (EC 3.2.1.-)
xylS
Alpha-xylosidase (EC 3.2.1.-)

Position: -111
Score: 5.4
Sequence: CATGGTTGGTTGCGGCAATCAAC
Position: -107
Score: 6.1
Sequence: GTTGGTTGCGGCAATCAACCAAC
Locus tag: LVIS_0185
Name: null
Funciton: hypothetical protein
Locus tag: LVIS_0186
Name: xylT
Funciton: D-xylose proton-symporter XylT
hypothetical protein
xylT
D-xylose proton-symporter XylT
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD