Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NiaR in Lactobacillus plantarum WCFS1

Properties
Regulator type: Transcription factor
TF locus tag: lp_2770
Regulator family: NiaR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Niacin
Regulog: NiaR - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -121
Score: 5.8
Sequence: TTTAGATGTCTTGACACCTATG
Locus tag: lp_2770
Name: niaR
Funciton: NAD biosynthesis transcription regulator, HTH_11 family
niaR
NAD biosynthesis transcription regulator, HTH_11 family

Position: -46
Score: 5.8
Sequence: CATAGGTGTCAAGACATCTAAA
Locus tag: lp_2771
Name: pncB
Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
pncB
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD