Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NiaR in Lactobacillus casei ATCC 334

Properties
Regulator type: Transcription factor
TF locus tag: LSEI_0807
Regulator family: NiaR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Niacin
Regulog: NiaR - Lactobacillaceae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -45
Score: 5
Sequence: CTAGGGTGTCAAGACACCCTAA
Locus tag: LSEI_2277
Name: niaP
Funciton: Niacin transporter NiaP
niaP
Niacin transporter NiaP
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD