Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Roseiflexus castenholzii DSM 13941

Properties
Regulator type: Transcription factor
TF locus tag: Rcas_3901, Rcas_1649
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Chloroflexia
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -58
Score: 4.3
Sequence: CATTGATATACACTATCATCA
Locus tag: Rcas_2945
Name: yciC
Funciton: Putative metal chaperone involved in Zn homeostasis, COG0523 family
yciC
Putative metal chaperone involved in Zn homeostasis, COG0523 family

Position: -122
Score: 5.3
Sequence: TATCCATACCACATATCAATA
Locus tag: Rcas_1591
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Rcas_1590
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Rcas_1589
Name: znuB
Funciton: Zinc ABC transporter, permease protein ZnuB
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, permease protein ZnuB
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD