Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FetR in Chloroflexus aggregans DSM 9485

Properties
Regulator type: Transcription factor
TF locus tag: Cagg_3304
Regulator family: DtxR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Regulog: FetR - Chloroflexia
Statistics of regulated genes:
- Genes 7
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -83
Score: 5.6
Sequence: ACGTTAGCATATACTAACCC
Locus tag: Cagg_2416
Name: fbpA
Funciton: Ferric iron ABC transporter, periplasmic-binding protein
Locus tag: Cagg_2417
Name: fbpB
Funciton: Ferric iron ABC transporter, permease protein
fbpA
Ferric iron ABC transporter, periplasmic-binding protein
fbpB
Ferric iron ABC transporter, permease protein

Position: -57
Score: 6
Sequence: AAATTAGTATATTCTAACTT
Locus tag: Cagg_3308
Name: hmuV
Funciton: Heme ABC transporter, ATPase component HmuV
Locus tag: Cagg_3307
Name: hmuT
Funciton: Heme ABC transporter, hemin-binding periplasmic component hmuT
Locus tag: Cagg_3306
Name: hmuU
Funciton: Heme ABC transporter, permease component HmuU
Locus tag: Cagg_3305
Name: COG2329
Funciton: hypothetical monooxygenase
Locus tag: Cagg_3304
Name: fetR
Funciton: Ferrous iron dependent repressor, DtxR family
hmuV
Heme ABC transporter, ATPase component HmuV
hmuT
Heme ABC transporter, hemin-binding periplasmic component hmuT
hmuU
Heme ABC transporter, permease component HmuU
COG2329
hypothetical monooxygenase
fetR
Ferrous iron dependent repressor, DtxR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD