Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FetR in Chloroflexus sp. Y-400-fl

Properties
Regulator type: Transcription factor
TF locus tag: Chy400_2620
Regulator family: DtxR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Regulog: FetR - Chloroflexia
Statistics of regulated genes:
- Genes 16
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -136
Score: 5.8
Sequence: TAATTAGCATACACTAACTA
Locus tag: Chy400_4135
Name: Haur_0321
Funciton: hypothetical transporter, MFS superfamily
Locus tag: Chy400_4136
Name: fepB
Funciton: Iron siderophore ABC transporter, periplasmic component
Haur_0321
hypothetical transporter, MFS superfamily
fepB
Iron siderophore ABC transporter, periplasmic component

Position: -158
Score: 6.2
Sequence: TTATTAGCATATACTAACCT
Locus tag: Chy400_0344
Name: COG0716
Funciton: flavodoxin
Locus tag: Chy400_0343
Name: null
Funciton: hypothetical protein
Locus tag: Chy400_0342
Name: fepB2
Funciton: Iron siderophore ABC transporter, periplasmic component
Locus tag: Chy400_0341
Name: null
Funciton: hypothetical protein
COG0716
flavodoxin
hypothetical protein
fepB2
Iron siderophore ABC transporter, periplasmic component
hypothetical protein

Position: -55
Score: 6.2
Sequence: TTATTAGTGTATACTAATAA
Locus tag: Chy400_0349
Name: fbpA
Funciton: Ferric iron ABC transporter, periplasmic-binding protein
Locus tag: Chy400_0348
Name: fbpB
Funciton: Ferric iron ABC transporter, permease protein
Locus tag: Chy400_0347
Name: fbpC
Funciton: Ferric iron ABC transporter, ATP-binding protein
fbpA
Ferric iron ABC transporter, periplasmic-binding protein
fbpB
Ferric iron ABC transporter, permease protein
fbpC
Ferric iron ABC transporter, ATP-binding protein

Position: -57
Score: 5.8
Sequence: AAATTAGAGTATTCTAATAG
Locus tag: Chy400_2616
Name: hmuV
Funciton: Heme ABC transporter, ATPase component HmuV
Locus tag: Chy400_2617
Name: hmuT
Funciton: Heme ABC transporter, hemin-binding periplasmic component hmuT
Locus tag: Chy400_2618
Name: hmuU
Funciton: Heme ABC transporter, permease component HmuU
Locus tag: Chy400_2619
Name: COG2329
Funciton: hypothetical monooxygenase
Locus tag: Chy400_2620
Name: fetR
Funciton: Ferrous iron dependent repressor, DtxR family
hmuV
Heme ABC transporter, ATPase component HmuV
hmuT
Heme ABC transporter, hemin-binding periplasmic component hmuT
hmuU
Heme ABC transporter, permease component HmuU
COG2329
hypothetical monooxygenase
fetR
Ferrous iron dependent repressor, DtxR family

Position: -92
Score: 5.8
Sequence: TTATTAGAGTATGCTAACCG
Locus tag: Chy400_0685
Name: RoseRS_4469
Funciton: hypothetical protein
Locus tag: Chy400_0686
Name: ftr
Funciton: High-affinity Fe2+ permease, FTR family
RoseRS_4469
hypothetical protein
ftr
High-affinity Fe2+ permease, FTR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD