Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FetR in Roseiflexus castenholzii DSM 13941

Properties
Regulator type: Transcription factor
TF locus tag: Rcas_4363
Regulator family: DtxR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Regulog: FetR - Chloroflexia
Statistics of regulated genes:
- Genes 17
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -159
Score: 5.5
Sequence: ATGTTAGAGTAACCTAACAC
Locus tag: Rcas_3171
Name: fbpA
Funciton: Ferric iron ABC transporter, periplasmic-binding protein
Locus tag: Rcas_3172
Name: fbpB
Funciton: Ferric iron ABC transporter, permease protein
fbpA
Ferric iron ABC transporter, periplasmic-binding protein
fbpB
Ferric iron ABC transporter, permease protein

Position: -98
Score: 6.3
Sequence: TTATTAGCATATGCTAACAT
Locus tag: Rcas_0821
Name: RoseRS_4469
Funciton: hypothetical protein
Locus tag: Rcas_0820
Name: ftr
Funciton: High-affinity Fe2+ permease, FTR family
Locus tag: Rcas_0819
Name: RoseRS_4467
Funciton: hypothetical protein
Locus tag: Rcas_0818
Name: RoseRS_4466
Funciton: hypothetical protein
RoseRS_4469
hypothetical protein
ftr
High-affinity Fe2+ permease, FTR family
RoseRS_4467
hypothetical protein
RoseRS_4466
hypothetical protein

Position: -123
Score: 5.9
Sequence: TTATTAGACTATACTAACTT
Locus tag: Rcas_4373
Name: hmuV
Funciton: Heme ABC transporter, ATPase component HmuV
Locus tag: Rcas_4372
Name: hmuT
Funciton: Heme ABC transporter, hemin-binding periplasmic component hmuT
Locus tag: Rcas_4371
Name: hmuU
Funciton: Heme ABC transporter, permease component HmuU
Locus tag: Rcas_4370
Name: RoseRS_3567
Funciton: hypothetical protein
Locus tag: Rcas_4369
Name: RoseRS_0755
Funciton: Hypothetical similar to CcmC, putative heme lyase for CcmE
Locus tag: Rcas_4368
Name: RoseRS_3569
Funciton: hypothetical protein
Locus tag: Rcas_4367
Name: COG2329
Funciton: hypothetical monooxygenase
Locus tag: Rcas_4366
Name: RoseRS_3571
Funciton: Hemin ABC transporter, permease protein
Locus tag: Rcas_4365
Name: RoseRS_3572
Funciton: hypothetical protein
Locus tag: Rcas_4364
Name: RoseRS_3573
Funciton: hypothetical protein
Locus tag: Rcas_4363
Name: fetR
Funciton: Ferrous iron dependent repressor, DtxR family
hmuV
Heme ABC transporter, ATPase component HmuV
hmuT
Heme ABC transporter, hemin-binding periplasmic component hmuT
hmuU
Heme ABC transporter, permease component HmuU
RoseRS_3567
hypothetical protein
RoseRS_0755
Hypothetical similar to CcmC, putative heme lyase for CcmE
RoseRS_3569
hypothetical protein
COG2329
hypothetical monooxygenase
RoseRS_3571
Hemin ABC transporter, permease protein
RoseRS_3572
hypothetical protein
RoseRS_3573
hypothetical protein
fetR
Ferrous iron dependent repressor, DtxR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD