Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MntR in Roseiflexus sp. RS-1

Properties
Regulator type: Transcription factor
TF locus tag: RoseRS_3986
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Chloroflexia
Statistics of regulated genes:
- Genes 8
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -29
Score: 5.5
Sequence: GTTTTAGGTCTACCTAAATT
Locus tag: RoseRS_3986
Name: mntR
Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
mntR
Mn-dependent transcriptional regulator MntR, DtxR family

Position: -85
Score: 6.3
Sequence: ATTTTAGGAATGCCTAAATT
Locus tag: RoseRS_4512
Name: MntR2
Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
Locus tag: RoseRS_4511
Name: feoB1
Funciton: Ferrous iron transport protein B
Locus tag: RoseRS_4510
Name: feoB2
Funciton: Ferrous iron transport protein B
MntR2
Mn-dependent transcriptional regulator MntR, DtxR family
feoB1
Ferrous iron transport protein B
feoB2
Ferrous iron transport protein B

Position: -42
Score: 5.6
Sequence: GATTTAGGCAAGACAAAATT
Locus tag: RoseRS_3070
Name: mntA
Funciton: Manganese ABC transporter, periplasmic-binding protein
Locus tag: RoseRS_3069
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: RoseRS_3068
Name: mntC
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: RoseRS_3067
Name: mntD
Funciton: Manganese ABC transporter, inner membrane permease protein
mntA
Manganese ABC transporter, periplasmic-binding protein
mntB
Manganese ABC transporter, ATP-binding protein
mntC
Manganese ABC transporter, inner membrane permease protein
mntD
Manganese ABC transporter, inner membrane permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD