Regulon of MntR in Herpetosiphon aurantiacus ATCC 23779
Regulator type: | Transcription factor |
TF locus tag: | Haur_4031 |
Regulator family: | DtxR |
Regulation mode: | repressor |
Biological process: | Manganese homeostasis |
Effector: | Manganese ion, (Mn2+) |
Regulog: | MntR - Chloroflexia |
Statistics of regulated genes: | |
- Genes | 4 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Chloroflexi
- By trascription factor - MntR
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
Locus Tag | Name | Function | |
---|---|---|---|
Position: -51
Score: 5.8 Sequence: CTTTTAGGTATGCCTAAATA
Locus tag: Haur_4030
Name: mntA Funciton: Manganese ABC transporter, periplasmic-binding protein
Locus tag: Haur_4029
Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Haur_4028
Name: mntC Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: Haur_4027
Name: mntD Funciton: Manganese ABC transporter, inner membrane permease protein |
|||
mntA
|
Manganese ABC transporter, periplasmic-binding protein
|
||
mntB
|
Manganese ABC transporter, ATP-binding protein
|
||
mntC
|
Manganese ABC transporter, inner membrane permease protein
|
||
mntD
|
Manganese ABC transporter, inner membrane permease protein
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |