Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MntR in Roseiflexus castenholzii DSM 13941

Properties
Regulator type: Transcription factor
TF locus tag: Rcas_3322
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Chloroflexia
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -9
Score: 5.8
Sequence: GTTTTAGGAATGCCTAAATA
Locus tag: Rcas_3322
Name: mntR
Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
mntR
Mn-dependent transcriptional regulator MntR, DtxR family

Position: -55
Score: 5.9
Sequence: ATTTTAGGATTTCCAAAATT
Locus tag: Rcas_1724
Name: mntA
Funciton: Manganese ABC transporter, periplasmic-binding protein
Locus tag: Rcas_1723
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Rcas_1722
Name: mntC
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: Rcas_1721
Name: mntD
Funciton: Manganese ABC transporter, inner membrane permease protein
mntA
Manganese ABC transporter, periplasmic-binding protein
mntB
Manganese ABC transporter, ATP-binding protein
mntC
Manganese ABC transporter, inner membrane permease protein
mntD
Manganese ABC transporter, inner membrane permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD