Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MntR in Chloroflexus sp. Y-400-fl

Properties
Regulator type: Transcription factor
TF locus tag: Chy400_0107
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Chloroflexia
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -40
Score: 5.8
Sequence: GATTTAGGTAAGGCTAAAAT
Locus tag: Chy400_0210
Name: mntA
Funciton: Manganese ABC transporter, periplasmic-binding protein
Locus tag: Chy400_0209
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Chy400_0208
Name: mntC
Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: Chy400_0207
Name: mntD
Funciton: Manganese ABC transporter, inner membrane permease protein
mntA
Manganese ABC transporter, periplasmic-binding protein
mntB
Manganese ABC transporter, ATP-binding protein
mntC
Manganese ABC transporter, inner membrane permease protein
mntD
Manganese ABC transporter, inner membrane permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD