Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModR in Chloroflexus sp. Y-400-fl

Properties
Regulator type: Transcription factor
TF locus tag: Chy400_2685
Regulator family: PadR
Regulation mode: repressor
Biological process: Molybdenum homeostasis
Effector: Molybdate
Regulog: ModR - Chloroflexia
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -102
Score: 6.9
Sequence: AGTATTCACATTGTGAATACT
Locus tag: Chy400_2685
Name: modR
Funciton: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
Locus tag: Chy400_2686
Name: modA
Funciton: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)
Locus tag: Chy400_2687
Name: modB
Funciton: Molybdate transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: Chy400_2688
Name: null
Funciton: ABC transporter related
Locus tag: Chy400_2689
Name: Cagg_1367
Funciton: Metal-dependent hydrolase
modR
Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
modA
Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)
modB
Molybdate transport system permease protein ModB (TC 3.A.1.8.1)
ABC transporter related
Cagg_1367
Metal-dependent hydrolase

Position: -166
Score: 6.9
Sequence: AGTATTCACAATGTGAATACT
Locus tag: Chy400_2684
Name: null
Funciton: oxidoreductase molybdopterin binding
oxidoreductase molybdopterin binding
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD