Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModR in Chloroflexus aggregans DSM 9485

Properties
Regulator type: Transcription factor
TF locus tag: Cagg_1371
Regulator family: PadR
Regulation mode: repressor
Biological process: Molybdenum homeostasis
Effector: Molybdate
Regulog: ModR - Chloroflexia
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -82
Score: 6.1
Sequence: AGTACTCACATCGTGAATATA
Locus tag: Cagg_1371
Name: modR
Funciton: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
Locus tag: Cagg_1370
Name: modA
Funciton: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)
Locus tag: Cagg_1369
Name: modB
Funciton: Molybdate transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: Cagg_1368
Name: modC
Funciton: Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1)
Locus tag: Cagg_1367
Name: Cagg_1367
Funciton: Metal-dependent hydrolase
modR
Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
modA
Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)
modB
Molybdate transport system permease protein ModB (TC 3.A.1.8.1)
modC
Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1)
Cagg_1367
Metal-dependent hydrolase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD