Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NrtR in Roseiflexus castenholzii DSM 13941

Properties
Regulator type: Transcription factor
TF locus tag: Rcas_0387
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Chloroflexia
Statistics of regulated genes:
- Genes 7
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -70
Score: 5.7
Sequence: TTATTGTTGTAATGACACTAA
Locus tag: Rcas_0387
Name: nrtR
Funciton: Nudix-related transcriptional regulator NrtR
Locus tag: Rcas_0388
Name: pncA
Funciton: Nicotinamidase (EC 3.5.1.19)
nrtR
Nudix-related transcriptional regulator NrtR
pncA
Nicotinamidase (EC 3.5.1.19)

Position: -53
Score: 6.1
Sequence: AAAGTGTTATACTAACACTAA
Locus tag: Rcas_2204
Name: nadE
Funciton: NAD synthetase (EC 6.3.1.5)
nadE
NAD synthetase (EC 6.3.1.5)

Position: -65
Score: 6.2
Sequence: ATAGAGTAACATTGACACTAA
Position: -11
Score: 6.6
Sequence: ATAGTGTAAAAATGACACTAA
Locus tag: Rcas_1005
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase (EC 2.4.2.19)
Locus tag: Rcas_1004
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: Rcas_1003
Name: nadB
Funciton: L-aspartate oxidase (EC 1.4.3.16)
nadC
Quinolinate phosphoribosyltransferase (EC 2.4.2.19)
nadA
Quinolinate synthetase (EC 4.1.99.-)
nadB
L-aspartate oxidase (EC 1.4.3.16)

Position: -39
Score: 5.8
Sequence: ATAGTGTCAATATCACAATAA
Locus tag: Rcas_1635
Name: null
Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD