Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NrtR in Herpetosiphon aurantiacus ATCC 23779

Properties
Regulator type: Transcription factor
TF locus tag: Haur_4290
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Chloroflexia
Statistics of regulated genes:
- Genes 8
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -54
Score: 5.9
Sequence: TTAGTGTATTATAGACACTAA
Locus tag: Haur_3381
Name: pncB
Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Locus tag: Haur_3382
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase (EC 2.4.2.19)
pncB
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
nadC
Quinolinate phosphoribosyltransferase (EC 2.4.2.19)

Position: -83
Score: 5.7
Sequence: TTAGTGTGATATTGACAAAAA
Position: -35
Score: 5.2
Sequence: TTGGTGTCATATTGACTATTA
Locus tag: Haur_2310
Name: nadD
Funciton: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
Locus tag: Haur_2309
Name: nadB
Funciton: L-aspartate oxidase (EC 1.4.3.16)
nadD
Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
nadB
L-aspartate oxidase (EC 1.4.3.16)

Position: -136
Score: 5.5
Sequence: AAATTGTCATCTTGACACTAC
Position: -110
Score: 5.4
Sequence: ATTGTGTTAGAATGACATTAT
Position: -49
Score: 6.2
Sequence: ATAGTGTCAAAATGACACTTA
Locus tag: Haur_1289
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
nadA
Quinolinate synthetase (EC 4.1.99.-)

Position: -32
Score: 6
Sequence: TTTGTGTCATAATAACACTAT
Locus tag: Haur_4290
Name: nrtR
Funciton: Nudix-related transcriptional regulator NrtR
Locus tag: Haur_4289
Name: nadE
Funciton: NAD synthetase (EC 6.3.1.5)
Locus tag: Haur_4288
Name: pncA
Funciton: Nicotinamidase (EC 3.5.1.19)
nrtR
Nudix-related transcriptional regulator NrtR
nadE
NAD synthetase (EC 6.3.1.5)
pncA
Nicotinamidase (EC 3.5.1.19)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD