Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NrtR in Chloroflexus sp. Y-400-fl

Properties
Regulator type: Transcription factor
TF locus tag: Chy400_3450
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Chloroflexia
Statistics of regulated genes:
- Genes 5
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -35
Score: 5.8
Sequence: TTAGTGTATAATTTACACTAT
Locus tag: Chy400_0205
Name: pncB
Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
pncB
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)

Position: -90
Score: 5.2
Sequence: TTAGTGACCTCTTGACAATAT
Position: -36
Score: 6.4
Sequence: AAAGTGTAATAATAACACTAA
Locus tag: Chy400_1521
Name: nadA
Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: Chy400_1522
Name: nadB
Funciton: L-aspartate oxidase (EC 1.4.3.16)
nadA
Quinolinate synthetase (EC 4.1.99.-)
nadB
L-aspartate oxidase (EC 1.4.3.16)

Position: -47
Score: 6.1
Sequence: TTAGTGTATAAATAACACTAA
Locus tag: Chy400_3450
Name: nrtR
Funciton: Nudix-related transcriptional regulator NrtR
nrtR
Nudix-related transcriptional regulator NrtR

Position: -37
Score: 5.7
Sequence: ATAGTGTCAGTTTTACACCAA
Locus tag: Chy400_4233
Name: pncA
Funciton: Nicotinamidase (EC 3.5.1.19)
pncA
Nicotinamidase (EC 3.5.1.19)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD