Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraR in Oenococcus oeni PSU-1

Properties
Regulator type: Transcription factor
TF locus tag: OEOE_0226
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Lactobacillaceae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -192
Score: 4.5
Sequence: TTATTTTTACAAAAAATTCA
Position: -179
Score: 5
Sequence: AAATTCATACGTAAAACTAA
Position: -149
Score: 5
Sequence: TGATTTATATGTACGAATGT
Locus tag: OEOE_0227
Name: araK
Funciton: Ribulokinase (EC 2.7.1.16)
araK
Ribulokinase (EC 2.7.1.16)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD