Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AraR in Lactobacillus fermentum IFO 3956

Properties
Regulator type: Transcription factor
TF locus tag: LAF_1556
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Regulog: AraR - Lactobacillaceae
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -105
Score: 5.9
Sequence: TGAATTGTACGGACAAATAT
Locus tag: LAF_1554
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araA
L-arabinose isomerase (EC 5.3.1.4)

Position: -153
Score: 4.4
Sequence: ATATTGTTCAGTATAATTTA
Locus tag: LAF_1555
Name: araE
Funciton: L-arabinose-proton symporter
araE
L-arabinose-proton symporter

Position: -77
Score: 5.9
Sequence: TGATTTATACGGACAAAAAA
Locus tag: LAF_1558
Name: araK
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: LAF_1557
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: LAF_1556
Name: araR
Funciton: Arabinoside utilization transcriptional repressor AraR, GntR family
araK
Ribulokinase (EC 2.7.1.16)
araD
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araR
Arabinoside utilization transcriptional repressor AraR, GntR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD