Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NagR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 79 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM 8 7
Lactobacillus brevis ATCC 367 5 4
Lactobacillus casei ATCC 334 4 3
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 4 4
Lactobacillus fermentum IFO 3956 1 1
Lactobacillus helveticus DPC 4571 4 4
Lactobacillus johnsonii NCC 533 5 4
Lactobacillus plantarum WCFS1 6 5
Lactobacillus reuteri JCM 1112 2 2
Lactobacillus rhamnosus GG 4 3
Lactobacillus sakei subsp. sakei 23K 5 4
Lactobacillus salivarius subsp. salivarius UCC118 3 3
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 4 2
Oenococcus oeni PSU-1 5 3
Pediococcus pentosaceus ATCC 25745 6 5
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nagA
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -66
score = 5.33704
sequence = TTTCTGGTCTATACCGATTA

Gene: LVIS_0539: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Lactobacillus casei ATCC 334

Site:
position = -73
score = 5.2667
sequence = ATCTTGGTCTATACCAGTTA

Gene: LSEI_1808: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -55
score = 5.24293
sequence = AGTTTGGTCTATACCGATTA

Gene: lp_0562: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Lactobacillus reuteri JCM 1112
*
Lactobacillus rhamnosus GG

Site:
position = -66
score = 4.53742
sequence = AGTCTGGTCTATACCGGTTA

Gene: LGG_01862: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -56
score = 5.69421
sequence = TTTTTGGTCTATACCATTTA

Gene: LSA1588: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -146
score = 5.48102
sequence = GTTTTGGTCTATACCAATTA

Site:
position = -93
score = 5.24587
sequence = TTCATGGTCTATACCATTTA

Gene: LSL_1466: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -82
score = 5.83021
sequence = TAATAGGTCTAGACCAATTA

Gene: LEUM_0425: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Oenococcus oeni PSU-1

Site:
position = -32
score = 4.41244
sequence = TAATTGGGCTATACCAAACC

Gene: OEOE_1728: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -57
score = 5.63596
sequence = TTTTTGGTCTATACCGATAT

Gene: PEPE_1528: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
nagR
*
Lactobacillus acidophilus NCFM

Site:
position = -66
score = 4.3596
sequence = AATGAAATCTAGACCAATTT

Gene: LBA0516: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0540: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
 
Lactobacillus casei ATCC 334

Gene: LSEI_1807: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0399: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0242: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
*
Lactobacillus helveticus DPC 4571

Site:
position = -35
score = 4.53545
sequence = AATGCAATCTAGACCAATTT

Gene: lhv_0534: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
 
Lactobacillus johnsonii NCC 533

Gene: LJ1739: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
 
Lactobacillus plantarum WCFS1

Gene: lp_0563: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
*
Lactobacillus reuteri JCM 1112

Site:
position = -82
score = 4.17949
sequence = AAATTGGTCTAGATTTTTGG

Gene: LAR_0271: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
 
Lactobacillus rhamnosus GG

Gene: LGG_01861: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1587: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1263: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0426: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
 
Oenococcus oeni PSU-1

Gene: OEOE_1727: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1527: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
 
CRON 2.
nagE
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*2
Lactobacillus plantarum WCFS1

Site:
position = -100
score = 4.18545
sequence = ACATTGGTCTATACACTTAG

Gene: lp_2531: N-acetylglucosamine and glucose PTS, EIICBA

Site:
position = -97
score = 4.97408
sequence = CCAATGGACTATACCAATAA

Gene: lp_2969: N-acetylglucosamine and glucose PTS, EIICBA
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -150
score = 5.32883
sequence = TATACGGTATAGACCAAAAT

Site:
position = -95
score = 5.06561
sequence = TTAAAGGTCTATACCAACTA

Gene: LSA0060: N-acetylglucosamine and glucose PTS, EIICBA
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -144
score = 5.77225
sequence = TAATAGGTATATACCAATTT

Site:
position = -100
score = 4.81875
sequence = AAAGCGGATTATACCAATAA

Gene: PEPE_1816: N-acetylglucosamine and glucose PTS, EIICBA
N-acetylglucosamine and glucose PTS, EIICBA
 
CRON 3.
celB
*
Lactobacillus acidophilus NCFM

Site:
position = -60
score = 4.87094
sequence = ATAGAGGTATATACCGAATT

Gene: LBA0491: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
*
Lactobacillus johnsonii NCC 533

Site:
position = -64
score = 5.77225
sequence = AAATAGGTATATACCAATTA

Gene: LJ0531: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
LBA0492
 
Lactobacillus acidophilus NCFM

Gene: LBA0492: hypothetical protein
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0532: hypothetical protein
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
hypothetical protein
 
CRON 4.
PF00248
*
Lactobacillus acidophilus NCFM

Site:
position = -102
score = 5.43176
sequence = TTAATGGTCTAGTCCATTAT

Site:
position = -82
score = 5.55983
sequence = AAAATGGAATAGACCATTTT

Gene: LBA1947: Oxidoreductase, aldo/keto reductase family
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1188: Oxidoreductase, aldo/keto reductase family
 
Lactobacillus casei ATCC 334

Gene: LSEI_0641: Oxidoreductase, aldo/keto reductase family
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -166
score = 5.66316
sequence = ATATTGGTATAGTCCATTTT

Site:
position = -127
score = 4.45943
sequence = GTCAAGGTCTAGACCGATAA

Gene: LBUL_2009: Oxidoreductase, aldo/keto reductase family
 
Lactobacillus fermentum IFO 3956
*
Lactobacillus helveticus DPC 4571

Site:
position = -103
score = 5.25592
sequence = TTACTGGTCTAGTCCATTAT

Site:
position = -83
score = 5.55983
sequence = AAAATGGAATAGACCATTTT

Gene: lhv_2076: Oxidoreductase, aldo/keto reductase family
*
Lactobacillus johnsonii NCC 533

Site:
position = -109
score = 5.3589
sequence = TCATTGGTCTAGTCCATTAT

Site:
position = -81
score = 5.42404
sequence = AAATTGGTCTAGTCAAATTA

Gene: LJ1822: Oxidoreductase, aldo/keto reductase family
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112

Gene: LAR_1240: Oxidoreductase, aldo/keto reductase family
 
Lactobacillus rhamnosus GG

Gene: LGG_00615: Oxidoreductase, aldo/keto reductase family
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Oxidoreductase, aldo/keto reductase family
 
CRON 5.
celB2
 
Lactobacillus acidophilus NCFM

Gene: LBA1369: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0733: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -165
score = 5.60455
sequence = TAATTGGTATATTCCATTAT

Gene: PEPE_0023: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
CRON 6.
nagA2
*
Lactobacillus acidophilus NCFM

Site:
position = -80
score = 5.20949
sequence = AAACTGGTATTGACCAATTT

Gene: LBA0144: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0171: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0514: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Lactobacillus johnsonii NCC 533

Gene: LJ0118: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_00334: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1754: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
CRON 7.
LBA0143
*
Lactobacillus acidophilus NCFM

Site:
position = -95
score = 5.20949
sequence = AAATTGGTCAATACCAGTTT

Gene: LBA0143: Maltodextrin glucosidase (EC 3.2.1.20)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_2769: Maltodextrin glucosidase (EC 3.2.1.20)
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -85
score = 4.61157
sequence = AAACTGGTATAGGCTATTTT

Gene: LBUL_0170: Maltodextrin glucosidase (EC 3.2.1.20)
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0152: Maltodextrin glucosidase (EC 3.2.1.20)
 
Lactobacillus johnsonii NCC 533

Gene: LJ0115: Maltodextrin glucosidase (EC 3.2.1.20)
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_02762: Maltodextrin glucosidase (EC 3.2.1.20)
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Maltodextrin glucosidase (EC 3.2.1.20)
 
CRON 8.
nagB
*
Lactobacillus acidophilus NCFM

Site:
position = -57
score = 5.55983
sequence = AAAATGGTCTATTCCATTTT

Site:
position = -37
score = 5.43176
sequence = ATAATGGACTAGACCATTAA

Gene: LBA1948: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Lactobacillus brevis ATCC 367

Site:
position = -58
score = 5.44973
sequence = AAATCGGTCTAGATCATTTA

Site:
position = -38
score = 4.97123
sequence = CAATTGGACTATACCATTAG

Gene: LVIS_0689: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Lactobacillus casei ATCC 334

Site:
position = -77
score = 5.01647
sequence = ATTACGGTATAGACCACTAT

Site:
position = -34
score = 5.05285
sequence = ACATTGGACTAGACCAGATA

Gene: LSEI_2889: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -92
score = 4.45943
sequence = TTATCGGTCTAGACCTTGAC

Site:
position = -53
score = 5.66316
sequence = AAAATGGACTATACCAATAT

Gene: LBUL_2010: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Lactobacillus fermentum IFO 3956
*
Lactobacillus helveticus DPC 4571

Site:
position = -54
score = 5.55983
sequence = AAAATGGTCTATTCCATTTT

Site:
position = -34
score = 5.25592
sequence = ATAATGGACTAGACCAGTAA

Gene: lhv_2077: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Lactobacillus johnsonii NCC 533

Site:
position = -65
score = 5.42404
sequence = TAATTTGACTAGACCAATTT

Site:
position = -37
score = 5.3589
sequence = ATAATGGACTAGACCAATGA

Gene: LJ1823: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Lactobacillus plantarum WCFS1

Site:
position = -60
score = 5.43108
sequence = ATTTTAGTCTAGACCAATAT

Site:
position = -39
score = 4.80394
sequence = CAATTGGACTATACCAAACA

Gene: lp_0226: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0980: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Lactobacillus rhamnosus GG

Site:
position = -78
score = 5.12678
sequence = AATTAGGTATAGACCATTGT

Site:
position = -35
score = 5.30262
sequence = ATATTGGACTAGACCAGATA

Gene: LGG_02913: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -55
score = 5.22459
sequence = TAATTGGACTATACCAATGG

Gene: LSA0417: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -92
score = 5.24587
sequence = TAAATGGTATAGACCATGAA

Site:
position = -39
score = 5.48102
sequence = TAATTGGTATAGACCAAAAC

Gene: LSL_1465: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -50
score = 5.42718
sequence = ATATTGGTATAGACCAAAAC

Site:
position = -35
score = 5.82979
sequence = AAAACGGTATAGACCAATTT

Gene: LEUM_0354: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Oenococcus oeni PSU-1

Site:
position = -84
score = 4.18963
sequence = CAAAAAAACTATACCAATTT

Gene: OEOE_0644: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -60
score = 5.41468
sequence = ATTTTGGTTTAGACCATTTT

Site:
position = -39
score = 5.59676
sequence = TAATTGGACTATACCAAAAA

Gene: PEPE_0335: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
pgi
 
Lactobacillus acidophilus NCFM

Gene: LBA0752: Glucose-6-phosphate isomerase (EC 5.3.1.9)
*
Lactobacillus brevis ATCC 367

Site:
position = -82
score = 5.08972
sequence = AATGTGGACTAGACCATTTA

Site:
position = -43
score = 4.46461
sequence = ATAATGGACTAGTCAATAAT

Gene: LVIS_1312: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Lactobacillus casei ATCC 334

Gene: LSEI_1126: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0625: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 2
Lactobacillus fermentum IFO 3956

Gene: LAF_1686: Glucose-6-phosphate isomerase (EC 5.3.1.9)

Gene: LAF_0411: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0795: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Lactobacillus johnsonii NCC 533

Gene: LJ0924: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Lactobacillus plantarum WCFS1

Gene: lp_2502: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0415: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Lactobacillus rhamnosus GG

Gene: LGG_01085: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1179: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0464: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0355: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 2
Oenococcus oeni PSU-1

Gene: OEOE_1524: Glucose-6-phosphate isomerase (EC 5.3.1.9)

Gene: OEOE_0636: Glucose-6-phosphate isomerase (EC 5.3.1.9)
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1350: Glucose-6-phosphate isomerase (EC 5.3.1.9)
Glucose-6-phosphate isomerase (EC 5.3.1.9)
glmS
*
Lactobacillus acidophilus NCFM

Site:
position = -52
score = 4.38699
sequence = AAAATAAACTAGTCCATTAA

Site:
position = -28
score = 4.60665
sequence = ATATTGAACTAGACCAAAGG

Gene: LBA0462: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Lactobacillus brevis ATCC 367

Site:
position = -106
score = 5.28448
sequence = ATTTCAGTCTATACCAATTT

Gene: LVIS_0687: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Lactobacillus casei ATCC 334

Site:
position = -159
score = 5.27046
sequence = AAATTAATATAGACCAATAT

Site:
position = -48
score = 5.17893
sequence = AAATCTGTCTAAACCAATTT

Gene: LSEI_1019: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -29
score = 4.68024
sequence = AAATTGAACTAGACCAAAGG

Gene: LBUL_0440: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Lactobacillus fermentum IFO 3956

Site:
position = -47
score = 4.87029
sequence = GAATTTATCTATACCAATTT

Gene: LAF_0382: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Lactobacillus helveticus DPC 4571

Site:
position = -131
score = 4.87012
sequence = AAAATTGATTATACCAATTT

Gene: lhv_0491: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Lactobacillus johnsonii NCC 533

Site:
position = -130
score = 5.14576
sequence = CTTTTGATATAGACCAATTA

Site:
position = -29
score = 4.44471
sequence = TAAATGAACTATACCAAAGG

Gene: LJ1581: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Lactobacillus plantarum WCFS1

Site:
position = -213
score = 4.1463
sequence = AGGTTAGACTAGACCAATTG

Gene: lp_0822: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Lactobacillus reuteri JCM 1112

Site:
position = -134
score = 4.43599
sequence = TAAATCATATAGACCAATCT

Site:
position = -43
score = 4.39827
sequence = CTAGTTATCTATACCAATTT

Gene: LAR_0405: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Lactobacillus rhamnosus GG

Site:
position = -47
score = 4.82617
sequence = AAACCTGTCTAAACCAATTT

Gene: LGG_00983: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -137
score = 4.02561
sequence = ACTCAGGGCTATACCAATGT

Site:
position = -114
score = 5.36255
sequence = TAATTGAAATATACCAATAA

Gene: LSA1355: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -58
score = 5.10512
sequence = ATCAAGGTCTATACCAATTT

Gene: LSL_1627: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0684: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Oenococcus oeni PSU-1

Site:
position = -113
score = 4.99244
sequence = TTAATGGCCTATACCAATGT

Gene: OEOE_0635: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -124
score = 5.01892
sequence = CATTTGATATATACCGATTT

Site:
position = -58
score = 4.01329
sequence = ATCGTTCTATATACCAATTT

Gene: PEPE_0478: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD