Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog YhcF - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM 7 2
Lactobacillus brevis ATCC 367 3 1
Lactobacillus casei ATCC 334 3 1
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 7 3
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571 7 2
Lactobacillus johnsonii NCC 533 6 2
Lactobacillus plantarum WCFS1 3 1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG 3 1
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ytsC
*
Lactobacillus acidophilus NCFM

Site:
position = -59
score = 6.33012
sequence = AGTGTATTAATTAAATAATACAGT

Gene: LBA1680: Putative antimicrobial peptide ABC exporter, ATP-binding subunit
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0387: Putative antimicrobial peptide ABC exporter, ATP-binding subunit
 
Lactobacillus casei ATCC 334

Gene: LSEI_1994: Putative antimicrobial peptide ABC exporter, ATP-binding subunit
*2
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -45
score = 4.37241
sequence = GGTGTATTACAACGGTAATACACC

Gene: LBUL_0989: Putative antimicrobial peptide ABC exporter, ATP-binding subunit

Site:
position = -45
score = 4.37241
sequence = GGTGTATTACAACGGTAATACACC

Gene: LBUL_1019: Putative antimicrobial peptide ABC exporter, ATP-binding subunit
 
Lactobacillus fermentum IFO 3956
*
Lactobacillus helveticus DPC 4571

Site:
position = -56
score = 5.46515
sequence = AGTGTATTGAGTTAATAATACAGT

Gene: lhv_1774: Putative antimicrobial peptide ABC exporter, ATP-binding subunit
*
Lactobacillus johnsonii NCC 533

Site:
position = -45
score = 5.26872
sequence = AGTGTAACAGGTACGTAATACACT

Gene: LJ0604: Putative antimicrobial peptide ABC exporter, ATP-binding subunit
 
Lactobacillus plantarum WCFS1

Gene: lp_2739: Putative antimicrobial peptide ABC exporter, ATP-binding subunit
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_01986: Putative antimicrobial peptide ABC exporter, ATP-binding subunit
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0127: Putative antimicrobial peptide ABC exporter, ATP-binding subunit
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1743: Putative antimicrobial peptide ABC exporter, ATP-binding subunit
Putative antimicrobial peptide ABC exporter, ATP-binding subunit
ytsB
 
Lactobacillus acidophilus NCFM

Gene: LBA1679: ABC-type antimicrobial peptide transport system, permease component
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0388: ABC-type antimicrobial peptide transport system, permease component
 
Lactobacillus casei ATCC 334

Gene: LSEI_1993: ABC-type antimicrobial peptide transport system, permease component
 2
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0990: ABC-type antimicrobial peptide transport system, permease component

Gene: LBUL_1018: ABC-type antimicrobial peptide transport system, permease component
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1773: ABC-type antimicrobial peptide transport system, permease component
 
Lactobacillus johnsonii NCC 533

Gene: LJ0605: ABC-type antimicrobial peptide transport system, permease component
 
Lactobacillus plantarum WCFS1

Gene: lp_2740: ABC-type antimicrobial peptide transport system, permease component
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_01985: ABC-type antimicrobial peptide transport system, permease component
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0128: ABC-type antimicrobial peptide transport system, permease component
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1744: ABC-type antimicrobial peptide transport system, permease component
ABC-type antimicrobial peptide transport system, permease component
 
CRON 2.
yhcF
*
Lactobacillus acidophilus NCFM

Site:
position = -43
score = 6.56192
sequence = ACTGTAATAGATAAATAATACAGT

Gene: LBA1189: Transcriptional regulator, GntR family
*
Lactobacillus brevis ATCC 367

Site:
position = -39
score = 6.56286
sequence = AGTGTAATAGTAAAATATAACACT

Gene: LVIS_2001: Transcriptional regulator, GntR family
*
Lactobacillus casei ATCC 334

Site:
position = -40
score = 6.91165
sequence = AGTGTATTAGTAATCTAATACACT

Gene: LSEI_1880: Transcriptional regulator, GntR family
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -38
score = 6.41754
sequence = AGTGTATTAGGTAACTAGTACAGT

Gene: LBUL_1563: Transcriptional regulator, GntR family
 
Lactobacillus fermentum IFO 3956
*
Lactobacillus helveticus DPC 4571

Site:
position = -44
score = 5.54546
sequence = AGTGTAATAGACATGTAATACAGC

Gene: lhv_1290: Transcriptional regulator, GntR family
*
Lactobacillus johnsonii NCC 533

Site:
position = -42
score = 6.35666
sequence = AGTGTAATAGATAAACCGTACACT

Gene: LJ1302: Transcriptional regulator, GntR family
*
Lactobacillus plantarum WCFS1

Site:
position = -39
score = 6.14523
sequence = ATTGTAATAGAAAAATAGAACACT

Gene: lp_2615: Transcriptional regulator, GntR family
 
Lactobacillus reuteri JCM 1112
*
Lactobacillus rhamnosus GG

Site:
position = -40
score = 6.63437
sequence = AGTGTAATAGATAGCTAATACACT

Gene: LGG_01937: Transcriptional regulator, GntR family
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -37
score = 6.50758
sequence = AGTGTATTAGAAAACTAGTACACA

Gene: PEPE_0054: Transcriptional regulator, GntR family
Transcriptional regulator, GntR family
yhcG
 
Lactobacillus acidophilus NCFM

Gene: LBA1188: ABC-type multidrug transport system, ATPase component
 
Lactobacillus brevis ATCC 367

Gene: LVIS_2000: ABC-type multidrug transport system, ATPase component
 
Lactobacillus casei ATCC 334

Gene: LSEI_1881: ABC-type multidrug transport system, ATPase component
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1562: ABC-type multidrug transport system, ATPase component
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1289: ABC-type multidrug transport system, ATPase component
 
Lactobacillus johnsonii NCC 533

Gene: LJ1301: ABC-type multidrug transport system, ATPase component
 
Lactobacillus plantarum WCFS1

Gene: lp_2614: ABC-type multidrug transport system, ATPase component
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_01938: ABC-type multidrug transport system, ATPase component
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0053: ABC-type multidrug transport system, ATPase component
ABC-type multidrug transport system, ATPase component
yhcI
 
Lactobacillus acidophilus NCFM

Gene: LBA1187: ABC-type multidrug transport system, permease component
 
Lactobacillus brevis ATCC 367

Gene: LVIS_1999: ABC-type multidrug transport system, permease component
 
Lactobacillus casei ATCC 334

Gene: LSEI_1882: ABC-type multidrug transport system, permease component
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1561: ABC-type multidrug transport system, permease component
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1288: ABC-type multidrug transport system, permease component
 
Lactobacillus johnsonii NCC 533

Gene: LJ1300: ABC-type multidrug transport system, permease component
 
Lactobacillus plantarum WCFS1

Gene: lp_2613: ABC-type multidrug transport system, permease component
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_01939: ABC-type multidrug transport system, permease component
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0052: ABC-type multidrug transport system, permease component
ABC-type multidrug transport system, permease component
yhcI2
 
Lactobacillus acidophilus NCFM

Gene: LBA1186: ABC-type multidrug transport system, permease component
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1287: ABC-type multidrug transport system, permease component
 
Lactobacillus johnsonii NCC 533

Gene: LJ1299: ABC-type multidrug transport system, permease component
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
ABC-type multidrug transport system, permease component
yhcI3
 
Lactobacillus acidophilus NCFM

Gene: LBA1184: ABC-type multidrug transport system, permease component
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1286: ABC-type multidrug transport system, permease component
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
ABC-type multidrug transport system, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD