Regulog BfrR - Chloroflexia
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructooligosaccharides utilization |
| Effector: | |
| Phylum: | Chloroflexi |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - LacI
- By pathway - Fructooligosaccharides utilization
| Genome | Genes | Operons |
|---|---|---|
| Chloroflexus sp. Y-400-fl | 5 | 1 |
| Chloroflexus aggregans DSM 9485 | 5 | 1 |
| Roseiflexus castenholzii DSM 13941 | ||
| Roseiflexus sp. RS-1 | ||
| Herpetosiphon aurantiacus ATCC 23779 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| bfrR |
*
Chloroflexus sp. Y-400-fl Site: position = -46 score = 6.17585 sequence = GTCAATGAACGACCAATCTC Gene: Chy400_2954: Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family |
*
Chloroflexus aggregans DSM 9485 Site: position = -46 score = 6.3673 sequence = GTCAATGGACGACCAATCTC Gene: Cagg_3715: Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family |
|
|
|
Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family |
| bfrE |
Gene: Chy400_2953: Fructooligosaccharides ABC transporter, substrate-binding protein |
Gene: Cagg_3716: Fructooligosaccharides ABC transporter, substrate-binding protein |
|
|
|
Fructooligosaccharides ABC transporter, substrate-binding protein |
| bfrF |
Gene: Chy400_2952: Fructooligosaccharides ABC transporter, permease protein 1 |
Gene: Cagg_3717: Fructooligosaccharides ABC transporter, permease protein 1 |
|
|
|
Fructooligosaccharides ABC transporter, permease protein 1 |
| bfrG |
Gene: Chy400_2951: Fructooligosaccharides ABC transporter, permease protein 2 |
Gene: Cagg_3718: Fructooligosaccharides ABC transporter, permease protein 2 |
|
|
|
Fructooligosaccharides ABC transporter, permease protein 2 |
| bfrA |
Gene: Chy400_2950: Beta-fructosidases (EC 3.2.1.26) |
Gene: Cagg_3719: Beta-fructosidases (EC 3.2.1.26) |
|
|
|
Beta-fructosidases (EC 3.2.1.26) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |