Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RhmR - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Rhamnose oligosaccharides utilization
Effector:
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485
Chloroflexus sp. Y-400-fl 5 1
Herpetosiphon aurantiacus ATCC 23779
Roseiflexus castenholzii DSM 13941
Roseiflexus sp. RS-1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rhmE
 
Chloroflexus aggregans DSM 9485
*
Chloroflexus sp. Y-400-fl

Site:
position = -177
score = 5.6567
sequence = CATACCGATCGATGCCCAGG

Gene: Chy400_0391: Predicted rhamnose oligosaccharide ABC transporter, extracellular solute-binding component
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Predicted rhamnose oligosaccharide ABC transporter, extracellular solute-binding component
rhmF
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_0390: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
rhmG
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_0389: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
rhmA
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_0388: alpha-L-rhamnosidase
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
alpha-L-rhamnosidase
GH1
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_0387: glycoside hydrolase family 1
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941
 
Roseiflexus sp. RS-1
glycoside hydrolase family 1
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD