Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog YxeR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Antibiotic resistance
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 20 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM 3 1
Lactobacillus brevis ATCC 367 3 1
Lactobacillus casei ATCC 334 3 1
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 3 1
Lactobacillus fermentum IFO 3956 3 1
Lactobacillus helveticus DPC 4571 3 1
Lactobacillus johnsonii NCC 533 3 1
Lactobacillus plantarum WCFS1
Lactobacillus reuteri JCM 1112 3 1
Lactobacillus rhamnosus GG 3 1
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1 3 1
Pediococcus pentosaceus ATCC 25745 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
yxeR
*
Lactobacillus acidophilus NCFM

Site:
position = -81
score = 3.62285
sequence = TTATTGACAACTCGTCACAAT

Gene: LBA1840: Predicted antibiotic resistance transcriptional reguator, TetR family
*
Lactobacillus brevis ATCC 367

Site:
position = -46
score = 5.08897
sequence = TAAGTGACGCCGTGTCACTTA

Site:
position = -90
score = 4.28818
sequence = AAGTTGACACGGTGTCACTCA

Gene: LVIS_2199: Predicted antibiotic resistance transcriptional reguator, TetR family
*
Lactobacillus casei ATCC 334

Site:
position = -77
score = 4.16518
sequence = ATGTTGACACGGTGTCACTTT

Site:
position = -33
score = 4.68857
sequence = TTAGTGACACCGTGTCACCAC

Gene: LSEI_0394: Predicted antibiotic resistance transcriptional reguator, TetR family
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -73
score = 3.11839
sequence = GTGTTGGAACGGTGTCACTTT

Site:
position = -29
score = 3.48738
sequence = AGGGTGACACGGTGTCACGGA

Gene: LBUL_1914: Predicted antibiotic resistance transcriptional reguator, TetR family
*
Lactobacillus fermentum IFO 3956

Site:
position = -83
score = 3.76478
sequence = AAGTTGACACGGTGTCACCTC

Site:
position = -42
score = 4.16518
sequence = CGAGTGACACGGTGTCACTAT

Gene: LAF_1826: Predicted antibiotic resistance transcriptional reguator, TetR family
*
Lactobacillus helveticus DPC 4571

Site:
position = -80
score = 4.49461
sequence = GTATTGACAATGCGTCACAAA

Gene: lhv_1880: Predicted antibiotic resistance transcriptional reguator, TetR family
*
Lactobacillus johnsonii NCC 533

Site:
position = -31
score = 4.96597
sequence = AAAGTGACACAGTGTCACAAG

Site:
position = -75
score = 4.16518
sequence = ATGTTGACACGGTGTCACTTT

Gene: LJ0539: Predicted antibiotic resistance transcriptional reguator, TetR family
 
Lactobacillus plantarum WCFS1
*
Lactobacillus reuteri JCM 1112

Site:
position = -38
score = 3.36439
sequence = ACGGTGACACGGTGTCACGAT

Site:
position = -83
score = 4.50545
sequence = TGATTGACATGGTGTCACTTT

Gene: LAR_1741: Predicted antibiotic resistance transcriptional reguator, TetR family
*
Lactobacillus rhamnosus GG

Site:
position = -122
score = 4.16518
sequence = AAGTTGACACCGTGTCACTAT

Site:
position = -78
score = 3.36439
sequence = ACGGTGACACGGTGTCACCAT

Gene: LGG_00488: Predicted antibiotic resistance transcriptional reguator, TetR family
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
*
Oenococcus oeni PSU-1

Site:
position = -35
score = 4.90585
sequence = TTAGTGACGTGGTGTCACTTA

Site:
position = -72
score = 3.64179
sequence = AAATTGACGCCGTGTCACCAT

Gene: OEOE_0733: Predicted antibiotic resistance transcriptional reguator, TetR family
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -41
score = 5.21197
sequence = TTGTTGACACGGTGTCATTTT

Site:
position = -76
score = 4.56558
sequence = ATTTTGACACGGTGTCACTTT

Gene: PEPE_0017: Predicted antibiotic resistance transcriptional reguator, TetR family
Predicted antibiotic resistance transcriptional reguator, TetR family
yxeA
 
Lactobacillus acidophilus NCFM

Gene: LBA1839: Predicted antimicrobial peptide transporter, permease protein
 
Lactobacillus brevis ATCC 367

Gene: LVIS_2198: Predicted antimicrobial peptide transporter, permease protein
 
Lactobacillus casei ATCC 334

Gene: LSEI_0395: Predicted antimicrobial peptide transporter, permease protein
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1913: Predicted antimicrobial peptide transporter, permease protein
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1825: Predicted antimicrobial peptide transporter, permease protein
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1879: Predicted antimicrobial peptide transporter, permease protein
 
Lactobacillus johnsonii NCC 533

Gene: LJ0540: Predicted antimicrobial peptide transporter, permease protein
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112

Gene: LAR_1740: Predicted antimicrobial peptide transporter, permease protein
 
Lactobacillus rhamnosus GG

Gene: LGG_00489: Predicted antimicrobial peptide transporter, permease protein
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1

Gene: OEOE_0734: Predicted antimicrobial peptide transporter, permease protein
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0018: Predicted antimicrobial peptide transporter, permease protein
Predicted antimicrobial peptide transporter, permease protein
yxeB
 
Lactobacillus acidophilus NCFM

Gene: LBA1838: Predicted antimicrobial peptide transporter, ATP-binding protein
 
Lactobacillus brevis ATCC 367

Gene: LVIS_2197: Predicted antimicrobial peptide transporter, ATP-binding protein
 
Lactobacillus casei ATCC 334

Gene: LSEI_0396: Predicted antimicrobial peptide transporter, ATP-binding protein
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1912: Predicted antimicrobial peptide transporter, ATP-binding protein
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1824: Predicted antimicrobial peptide transporter, ATP-binding protein
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1878: Predicted antimicrobial peptide transporter, ATP-binding protein
 
Lactobacillus johnsonii NCC 533

Gene: LJ0541: Predicted antimicrobial peptide transporter, ATP-binding protein
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112

Gene: LAR_1739: Predicted antimicrobial peptide transporter, ATP-binding protein
 
Lactobacillus rhamnosus GG

Gene: LGG_00490: Predicted antimicrobial peptide transporter, ATP-binding protein
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1

Gene: OEOE_0735: Predicted antimicrobial peptide transporter, ATP-binding protein
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0019: Predicted antimicrobial peptide transporter, ATP-binding protein
Predicted antimicrobial peptide transporter, ATP-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD