Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog YwzG - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: PadR
Regulation mode: repressor
Biological process: Transport
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367 3 1
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1 3 1
Lactobacillus reuteri JCM 1112 3 1
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118 4 1
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 3 1
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ywzG
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -36
score = 7.05067
sequence = ATATTATACGTCGTATAGTAT

Gene: LVIS_0242: Predicted transcriptional regulator, PadR family
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0572: Predicted transcriptional regulator, PadR family
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -37
score = 7.05067
sequence = ATACTATACGACGTATAATAT

Gene: lp_3216: Predicted transcriptional regulator, PadR family
*
Lactobacillus reuteri JCM 1112

Site:
position = -44
score = 7.20334
sequence = ATATTATATGACATATAATAT

Gene: LAR_0307: Predicted transcriptional regulator, PadR family
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -59
score = 6.88491
sequence = ATATTATATGATATATAATAT

Gene: LSL_0105: Predicted transcriptional regulator, PadR family
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -35
score = 7.10156
sequence = ATATTATATGTCGTATAGTAT

Gene: LEUM_2026: Predicted transcriptional regulator, PadR family
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -36
score = 6.78313
sequence = ATACTATATGAGATATAGTAT

Gene: PEPE_1823: Predicted transcriptional regulator, PadR family
Predicted transcriptional regulator, PadR family
lp_3217
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0243: Predicted integral membrane protein
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_3217: Predicted integral membrane protein
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0308: Predicted integral membrane protein
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0106: Predicted integral membrane protein
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_2025: Predicted integral membrane protein
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1824: Predicted integral membrane protein
Predicted integral membrane protein
lp_3218
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0244: Conserved hypothetical protein
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_3218: Conserved hypothetical protein
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0309: Conserved hypothetical protein
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0107: Conserved hypothetical protein
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_2024: Conserved hypothetical protein
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1825: Conserved hypothetical protein
Conserved hypothetical protein
COG1983
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_0108: Putative stress-responsive transcriptional regulator
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Putative stress-responsive transcriptional regulator
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD