Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog YtrA - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Hypothetical ABC transporter
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367 3 1
Lactobacillus casei ATCC 334 1 1
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 2 1
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1 4 1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG 3 1
Lactobacillus sakei subsp. sakei 23K 4 1
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 5 1
Oenococcus oeni PSU-1 4 1
Pediococcus pentosaceus ATCC 25745
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ytrA
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -60
score = 6.74141
sequence = GTGTACTAGGTATAATAGTACAG

Gene: LVIS_0408: Predicted transcriptional regulator, GntR family
*
Lactobacillus casei ATCC 334

Site:
position = -46
score = 6.94443
sequence = GTGTACTACGTATAATAGTACAC

Gene: LSEI_2244: Predicted transcriptional regulator, GntR family
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -50
score = 6.66981
sequence = GTGTACTAGAATAAATAGTACAG

Gene: LBUL_1589: Predicted transcriptional regulator, GntR family
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*2
Lactobacillus plantarum WCFS1

Gene: lp_0325: Predicted transcriptional regulator, GntR family

Site:
position = -49
score = 6.25128
sequence = GTGTACTAGTTGTAGTAATACAC

Gene: lp_1959: Predicted transcriptional regulator, GntR family
 
Lactobacillus reuteri JCM 1112
*
Lactobacillus rhamnosus GG

Site:
position = -46
score = 6.6648
sequence = GTGTACTGCGTATAATAGTACAC

Gene: LGG_02246: Predicted transcriptional regulator, GntR family
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -61
score = 6.78114
sequence = GTGTACTACGTATAATAGTACAG

Gene: LSA1419: Predicted transcriptional regulator, GntR family
 
Lactobacillus salivarius subsp. salivarius UCC118
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -123
score = 6.62508
sequence = GTGTACTGTGTATTATAGTACAC

Gene: LEUM_0050: Predicted transcriptional regulator, GntR family
 
Oenococcus oeni PSU-1

Gene: OEOE_1803: Predicted transcriptional regulator, GntR family
 
Pediococcus pentosaceus ATCC 25745
Predicted transcriptional regulator, GntR family
ytrB
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0409: Predicted ABC transporter, ATP-binding protein
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_1588: Predicted ABC transporter, ATP-binding protein
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 2
Lactobacillus plantarum WCFS1

Gene: lp_0326: Predicted ABC transporter, ATP-binding protein

Gene: lp_1958: Predicted ABC transporter, ATP-binding protein
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_02245: Predicted ABC transporter, ATP-binding protein
 2
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1418: Predicted ABC transporter, ATP-binding protein

Gene: LSA1417: Predicted ABC transporter, ATP-binding protein
 
Lactobacillus salivarius subsp. salivarius UCC118
 2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0051: Predicted ABC transporter, ATP-binding protein

Gene: LEUM_0053: Predicted ABC transporter, ATP-binding protein
*2
Oenococcus oeni PSU-1

Gene: OEOE_1802: Predicted ABC transporter, ATP-binding protein

Site:
position = -45
score = 6.57625
sequence = CTGTACTAATTAATATAGTACAC

Gene: OEOE_1805: Predicted ABC transporter, ATP-binding protein
 
Pediococcus pentosaceus ATCC 25745
Predicted ABC transporter, ATP-binding protein
LEUM_0052
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0052: Hypothetical protein
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Hypothetical protein
OEOE_1804
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0054: Predicted ABC transporter, permease protein
 
Oenococcus oeni PSU-1

Gene: OEOE_1804: Predicted ABC transporter, permease protein
 
Pediococcus pentosaceus ATCC 25745
Predicted ABC transporter, permease protein
lp_1957
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_1957: ABC transporter, permease protein
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
ABC transporter, permease protein
lp_1956
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_1956: ABC transporter, permease protein
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
ABC transporter, permease protein
lp_0327
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0410: Predicted ABC transporter, permease protein
 
Lactobacillus casei ATCC 334

Gene: LSEI_2242: Predicted ABC transporter, permease protein
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_0327: Predicted ABC transporter, permease protein
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_02244: Predicted ABC transporter, permease protein
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1416: Predicted ABC transporter, permease protein
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Predicted ABC transporter, permease protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD