Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Lp_2742 - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug efflux; Multidrug resistance
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367 3 1
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956 3 1
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1 6 1
Lactobacillus reuteri JCM 1112 3 1
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K 3 1
Lactobacillus salivarius subsp. salivarius UCC118 3 1
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
lp_2739
 
Lactobacillus acidophilus NCFM

Gene: LBA1680: Predicted antimicrobial peptide ABC transporter, ATP-binding protein
*
Lactobacillus brevis ATCC 367

Site:
position = -46
score = 6.67078
sequence = TTAATTACACAAGTAACTAA

Gene: LVIS_0387: Predicted antimicrobial peptide ABC transporter, ATP-binding protein
 
Lactobacillus casei ATCC 334

Gene: LSEI_1994: Predicted antimicrobial peptide ABC transporter, ATP-binding protein
 2
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0989: Predicted antimicrobial peptide ABC transporter, ATP-binding protein

Gene: LBUL_1019: Predicted antimicrobial peptide ABC transporter, ATP-binding protein
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1774: Predicted antimicrobial peptide ABC transporter, ATP-binding protein
 
Lactobacillus johnsonii NCC 533

Gene: LJ0604: Predicted antimicrobial peptide ABC transporter, ATP-binding protein
*
Lactobacillus plantarum WCFS1

Site:
position = -59
score = 6.83482
sequence = TTAGTTACATAAGTAATTAA

Gene: lp_2739: Predicted antimicrobial peptide ABC transporter, ATP-binding protein
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_01986: Predicted antimicrobial peptide ABC transporter, ATP-binding protein
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0127: Predicted antimicrobial peptide ABC transporter, ATP-binding protein
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -42
score = 6.67078
sequence = TTAGTTACACAAGTAATTAA

Gene: PEPE_1743: Predicted antimicrobial peptide ABC transporter, ATP-binding protein
Predicted antimicrobial peptide ABC transporter, ATP-binding protein
lp_2740
 
Lactobacillus acidophilus NCFM

Gene: LBA1679: Predicted antimicrobial peptide ABC transporter, permease protein
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0388: Predicted antimicrobial peptide ABC transporter, permease protein
 
Lactobacillus casei ATCC 334

Gene: LSEI_1993: Predicted antimicrobial peptide ABC transporter, permease protein
 2
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0990: Predicted antimicrobial peptide ABC transporter, permease protein

Gene: LBUL_1018: Predicted antimicrobial peptide ABC transporter, permease protein
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1773: Predicted antimicrobial peptide ABC transporter, permease protein
 
Lactobacillus johnsonii NCC 533

Gene: LJ0605: Predicted antimicrobial peptide ABC transporter, permease protein
 
Lactobacillus plantarum WCFS1

Gene: lp_2740: Predicted antimicrobial peptide ABC transporter, permease protein
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_01985: Predicted antimicrobial peptide ABC transporter, permease protein
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0128: Predicted antimicrobial peptide ABC transporter, permease protein
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1744: Predicted antimicrobial peptide ABC transporter, permease protein
Predicted antimicrobial peptide ABC transporter, permease protein
lp_2741
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_2741: Predicted integral membrane protein
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Predicted integral membrane protein
lp_2742
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0389: Transcriptional regulator, GntR family
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -48
score = 6.67078
sequence = TTAGTTACACAAGTAATTAA

Gene: LAF_1400: Transcriptional regulator, GntR family
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_2742: Transcriptional regulator, GntR family
*
Lactobacillus reuteri JCM 1112

Site:
position = -48
score = 6.4641
sequence = TTAGTTACATAAGTGATTAA

Gene: LAR_1262: Transcriptional regulator, GntR family
 
Lactobacillus rhamnosus GG
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -262
score = 6.4641
sequence = TTAACTACATAAGTAACTAA

Gene: LSA0929: Transcriptional regulator, GntR family
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -52
score = 6.83482
sequence = TTAGTTACATAAGTAATTAA

Gene: LSL_1617: Transcriptional regulator, GntR family
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -61
score = 6.30006
sequence = TTAGTTACATGACTAATTAA

Gene: PEPE_1308: Transcriptional regulator, GntR family
Transcriptional regulator, GntR family
lp_2743
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1399: ABC-type multidrug transport system, ATPase component
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_2743: ABC-type multidrug transport system, ATPase component
 
Lactobacillus reuteri JCM 1112

Gene: LAR_1261: ABC-type multidrug transport system, ATPase component
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0930: ABC-type multidrug transport system, ATPase component
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1616: ABC-type multidrug transport system, ATPase component
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1307: ABC-type multidrug transport system, ATPase component
ABC-type multidrug transport system, ATPase component
lp_2744
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1398: ABC-type multidrug transport system, permease component
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_2744: ABC-type multidrug transport system, permease component
 
Lactobacillus reuteri JCM 1112

Gene: LAR_1260: ABC-type multidrug transport system, permease component
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0931: ABC-type multidrug transport system, permease component
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1615: ABC-type multidrug transport system, permease component
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 2
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1305: ABC-type multidrug transport system, permease component

Gene: PEPE_1306: ABC-type multidrug transport system, permease component
ABC-type multidrug transport system, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD