Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MtlR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: activator
Biological process: Mannitol utilization
Effector: HPr, phosphocarrier protein; MtlA, mannitol-specific enzyme IICB PTS component
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334 4 1
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1 4 1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG 4 1
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118 3 1
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mtlA
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
*
Lactobacillus casei ATCC 334

Site:
position = -96
score = 7.48093
sequence = TTTGGCACAGACAACTGTGCCAAA

Gene: LSEI_2888: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -104
score = 6.66462
sequence = TGTGGCACAGTTTCCTGTGCCACG

Gene: lp_0230: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
 
Lactobacillus reuteri JCM 1112
*
Lactobacillus rhamnosus GG

Site:
position = -96
score = 7.23981
sequence = TTTGGCACAACTAACTGTGCCAAA

Gene: LGG_02912: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
 
Lactobacillus sakei subsp. sakei 23K
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -110
score = 6.90296
sequence = TTTGACACTGACAACTGTGCCAAA

Gene: LSL_1620: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
mtlR
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_2887: Mannitol utilization transcription activator MtlR, BglG family
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_0231: Mannitol utilization transcription activator MtlR, BglG family
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_02911: Mannitol utilization transcription activator MtlR, BglG family
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1628: Mannitol utilization transcription activator MtlR, BglG family
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Mannitol utilization transcription activator MtlR, BglG family
mtlF
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_2886: PTS system, mannitol-specific IIA component (EC 2.7.1.69)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_0232: PTS system, mannitol-specific IIA component (EC 2.7.1.69)
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_02910: PTS system, mannitol-specific IIA component (EC 2.7.1.69)
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1619: PTS system, mannitol-specific IIA component (EC 2.7.1.69)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
PTS system, mannitol-specific IIA component (EC 2.7.1.69)
mtlD
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_2885: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_0233: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_02909: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1618: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD