Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Rcas_3562 - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Alpha-galactosides utilization
Effector:
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485
Chloroflexus sp. Y-400-fl
Herpetosiphon aurantiacus ATCC 23779
Roseiflexus castenholzii DSM 13941 8 1
Roseiflexus sp. RS-1 8 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Rcas_3562
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
*
Roseiflexus castenholzii DSM 13941

Site:
position = -44
score = 7.4345
sequence = TGTCTTATATCCTATGCCATAGGACA

Gene: Rcas_3562: Transcriptional regulator, GntR family
*
Roseiflexus sp. RS-1

Site:
position = -47
score = 7.09512
sequence = TGTCCTGCATCCTATGCAATAAGACA

Gene: RoseRS_1355: Transcriptional regulator, GntR family
Transcriptional regulator, GntR family
galZ
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_3563: Alpha-galactosidase (EC 3.2.1.22)
 
Roseiflexus sp. RS-1

Gene: RoseRS_1356: Alpha-galactosidase (EC 3.2.1.22)
Alpha-galactosidase (EC 3.2.1.22)
abcP
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_3564: sugar ABC transporter, permease protein
 
Roseiflexus sp. RS-1

Gene: RoseRS_1357: sugar ABC transporter, permease protein
sugar ABC transporter, permease protein
abcT
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_3565: sugar ABC transporter, permease 2
 
Roseiflexus sp. RS-1

Gene: RoseRS_1358: sugar ABC transporter, permease 2
sugar ABC transporter, permease 2
abcB
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_3566: sugar ABC transport system, sugar-binding protein
 
Roseiflexus sp. RS-1

Gene: RoseRS_1359: sugar ABC transport system, sugar-binding protein
sugar ABC transport system, sugar-binding protein
galY
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_3567: Alpha-galactosidase (EC 3.2.1.22)
 
Roseiflexus sp. RS-1

Gene: RoseRS_1360: Alpha-galactosidase (EC 3.2.1.22)
Alpha-galactosidase (EC 3.2.1.22)
Rcas_3568
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_3568: hypothetical protein
 
Roseiflexus sp. RS-1

Gene: RoseRS_1361: hypothetical protein
hypothetical protein
Rcas_3569
 
Chloroflexus aggregans DSM 9485
 
Chloroflexus sp. Y-400-fl
 
Herpetosiphon aurantiacus ATCC 23779
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_3569: Putative oxidoreductase
 
Roseiflexus sp. RS-1

Gene: RoseRS_1362: Putative oxidoreductase
Putative oxidoreductase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD