Regulog HcpR - Chloroflexia
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Phylum: | Chloroflexi |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By trascription factor - HcpR
- By TF family - CRP
- By effector - Nitric oxide
- By pathway - Nitrosative stress response
| Genome | Genes | Operons |
|---|---|---|
| Chloroflexus aggregans DSM 9485 | 4 | 2 |
| Chloroflexus sp. Y-400-fl | ||
| Herpetosiphon aurantiacus ATCC 23779 | ||
| Roseiflexus castenholzii DSM 13941 | 2 | 1 |
| Roseiflexus sp. RS-1 | 2 | 1 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| Rcas_3898 |
*2
Chloroflexus aggregans DSM 9485 Site: position = -116 score = 6.47832 sequence = ATCTTGCGCTAGCGCAACGA Gene: Cagg_2026: Cytochrome c family protein involved in nitrosative stress Site: position = -86 score = 6.80655 sequence = AAGTTGCGCTAGCGCAACGT Gene: Cagg_2669: Cytochrome c family protein involved in nitrosative stress |
|
|
*
Roseiflexus castenholzii DSM 13941 Site: position = -111 score = 6.46055 sequence = AACTTGCGCCAGCGCAACGA Gene: Rcas_3898: Cytochrome c family protein involved in nitrosative stress |
*
Roseiflexus sp. RS-1 Site: position = -105 score = 6.46055 sequence = AACTTGCGCCAGCGCAACGA Gene: RoseRS_0596: Cytochrome c family protein involved in nitrosative stress |
Cytochrome c family protein involved in nitrosative stress |
| Rcas_3899 |
2
Chloroflexus aggregans DSM 9485 Gene: Cagg_2025: hypothetical protein involved in nitrosative stress Gene: Cagg_2670: hypothetical protein involved in nitrosative stress |
|
|
Gene: Rcas_3899: hypothetical protein involved in nitrosative stress |
Gene: RoseRS_0597: hypothetical protein involved in nitrosative stress |
hypothetical protein involved in nitrosative stress |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |