Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog YybA - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: MarR
Regulation mode:
Biological process: unknown
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM 2 1
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533 2 1
Lactobacillus plantarum WCFS1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
yybA
*
Lactobacillus acidophilus NCFM

Site:
position = -51
score = 7.81073
sequence = TTTTTGTTGCAAATGCAACAAAAA

Gene: LBA1663: Predicted transcriptional regulator, MarR family
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
*
Lactobacillus johnsonii NCC 533

Site:
position = -67
score = 7.81073
sequence = TTATTGTCGCATTTGCAACAATAA

Gene: LJ0661: Predicted transcriptional regulator, MarR family
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Predicted transcriptional regulator, MarR family
LBA1664
 
Lactobacillus acidophilus NCFM

Gene: LBA1664: Protease synthase and sporulation negative regulatory protein PAI 1
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0662: Protease synthase and sporulation negative regulatory protein PAI 1
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Protease synthase and sporulation negative regulatory protein PAI 1
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD