Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TreR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Trehalose utilization
Effector: Trehalose-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM 3 2
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334 3 1
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533 3 2
Lactobacillus plantarum WCFS1 3 1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG 3 1
Lactobacillus sakei subsp. sakei 23K 3 2
Lactobacillus salivarius subsp. salivarius UCC118 3 2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 3 1
Oenococcus oeni PSU-1 3 1
Pediococcus pentosaceus ATCC 25745 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
treP
*
Lactobacillus acidophilus NCFM

Site:
position = -68
score = 6.54405
sequence = CAACTTGTATATACAAGTTT

Site:
position = -146
score = 5.37691
sequence = ATAAATGTATAGACAAGTAA

Gene: LBA1012: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0631: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
*
Lactobacillus johnsonii NCC 533

Site:
position = -75
score = 6.08495
sequence = CAACTTGTACAGACAAGTAT

Site:
position = -164
score = 5.18226
sequence = ACACTTGATTAGACAAGTAA

Gene: LJ0760: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)
 3
Lactobacillus plantarum WCFS1

Gene: lp_0264: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)

Gene: lp_0265: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)

Gene: lp_3240: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_00603: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -78
score = 6.01017
sequence = CAACTTGTCTATACATGTTG

Gene: LSA1200: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -158
score = 4.8101
sequence = ATAGATGTATATACAATATA

Site:
position = -68
score = 6.34987
sequence = CAACTTGTATATACAAGTGA

Gene: LSL_1512: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)
*2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0508: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)

Site:
position = -40
score = 5.81875
sequence = TAACTAGTACGTACAAGTTG

Gene: LEUM_0507: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)
*2
Oenococcus oeni PSU-1

Site:
position = -31
score = 5.54009
sequence = AAAGTTGTACGTACAAGTGA

Gene: OEOE_1342: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)

Gene: OEOE_1341: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -95
score = 6.12108
sequence = CATCTTGTATATACAAGTTT

Site:
position = -171
score = 5.78258
sequence = TAACTAGTATATACAAGGTA

Gene: PEPE_1804: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)
Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)
treA
 
Lactobacillus acidophilus NCFM

Gene: LBA1014: Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0630: Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0758: Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
 
Lactobacillus plantarum WCFS1

Gene: lp_0263: Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_00602: Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1199: Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1514: Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0509: Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
 
Oenococcus oeni PSU-1

Gene: OEOE_1340: Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1806: Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
treR
*
Lactobacillus acidophilus NCFM

Site:
position = -56
score = 5.1928
sequence = TTACTTGTCTATACATTTAT

Site:
position = -134
score = 6.59816
sequence = AAACTTGTATATACAAGTTG

Gene: LBA1013: Trehalose utilization transcriptional repressor TreR, GntR family
 
Lactobacillus brevis ATCC 367
*
Lactobacillus casei ATCC 334

Site:
position = -61
score = 5.20541
sequence = ATACCTGTACGTACAGGTAA

Gene: LSEI_0629: Trehalose utilization transcriptional repressor TreR, GntR family
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
*
Lactobacillus johnsonii NCC 533

Site:
position = 39
score = 5.9293
sequence = ATACTTGTCTGTACAAGTTG

Gene: LJ0759: Trehalose utilization transcriptional repressor TreR, GntR family
*
Lactobacillus plantarum WCFS1

Site:
position = -59
score = 5.56169
sequence = CAACTTGTCTAAACAAGTCT

Gene: lp_0262: Trehalose utilization transcriptional repressor TreR, GntR family
 
Lactobacillus reuteri JCM 1112
*
Lactobacillus rhamnosus GG

Site:
position = -61
score = 5.61797
sequence = ATACCTGTACGTACAAGTAG

Gene: LGG_00601: Trehalose utilization transcriptional repressor TreR, GntR family
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -113
score = 6.07624
sequence = CAACATGTATAGACAAGTTG

Gene: LSA1201: Trehalose utilization transcriptional repressor TreR, GntR family
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -162
score = 6.25145
sequence = TCACTTGTATATACAAGTTG

Gene: LSL_1513: Trehalose utilization transcriptional repressor TreR, GntR family
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0510: Trehalose utilization transcriptional repressor TreR, GntR family
 
Oenococcus oeni PSU-1

Gene: OEOE_1339: Trehalose utilization transcriptional repressor TreR, GntR family
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -66
score = 5.68826
sequence = TACCTTGTATATACTAGTTA

Site:
position = -142
score = 6.17518
sequence = AAACTTGTATATACAAGATG

Gene: PEPE_1805: Trehalose utilization transcriptional repressor TreR, GntR family
Trehalose utilization transcriptional regulator TreR, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD