Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PadR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: PadR
Regulation mode: repressor
Biological process: Phenolic acid stress response
Effector: p-Coumaric acid; Ferulic acid
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367 2 2
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1 2 2
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K 1 1
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
padC
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -48
score = 7.11802
sequence = AAACATGTAATTAATTACATGTTC

Gene: LVIS_0213: Phenolic acid decarboxylase (EC 4.1.1.-)
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -59
score = 7.45816
sequence = AAACATGTAATAAATTACATGATT

Gene: lp_3665: Phenolic acid decarboxylase (EC 4.1.1.-)
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -41
score = 7.19759
sequence = AAACATGTAATTAATTACATGATA

Gene: LSA1701: Phenolic acid decarboxylase (EC 4.1.1.-)
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = 7
score = 6.40489
sequence = AAACTTTTAAAACTTTAGATGACT

Gene: PEPE_0491: Phenolic acid decarboxylase (EC 4.1.1.-)
Phenolic acid decarboxylase (EC 4.1.1.-)
padR
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -208
score = 7.09299
sequence = GAACATGTAATTAATTACATGTTT

Gene: LVIS_0214: Phenolic acid stress response transcriptional regulator PadR, PadR family
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1009: Phenolic acid stress response transcriptional regulator PadR, PadR family
 
Lactobacillus helveticus DPC 4571

Gene: lhv_1703: Phenolic acid stress response transcriptional regulator PadR, PadR family
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -80
score = 6.89693
sequence = AATCATGTAATTTATTACATGTTT

Gene: lp_3664: Phenolic acid stress response transcriptional regulator PadR, PadR family
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA0265: Phenolic acid stress response transcriptional regulator PadR, PadR family
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0492: Phenolic acid stress response transcriptional regulator PadR, PadR family
Phenolic acid stress response transcriptional regulator PadR, PadR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD