Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode:
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334 2 1
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 1 1
Lactobacillus fermentum IFO 3956 2 1
Lactobacillus helveticus DPC 4571 2 1
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1 1 1
Lactobacillus reuteri JCM 1112 2 1
Lactobacillus rhamnosus GG 2 1
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 1 1
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pncA
 
Lactobacillus acidophilus NCFM

Gene: LBA1422: Nicotinamidase (EC 3.5.1.19)
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0241: Nicotinamidase (EC 3.5.1.19)
*
Lactobacillus casei ATCC 334

Site:
position = -40
score = 6.2844
sequence = TTTAAGTAAAAAATACTTTTA

Gene: LSEI_2767: Nicotinamidase (EC 3.5.1.19)
*
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Site:
position = -55
score = 6.03384
sequence = TTTAGGTAAGTTATACTTTTA

Gene: LBUL_0279: Nicotinamidase (EC 3.5.1.19)
*
Lactobacillus fermentum IFO 3956

Site:
position = -54
score = 6.03384
sequence = TTTAGGTATTTTTTACTTTAA

Gene: LAF_1390: Nicotinamidase (EC 3.5.1.19)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0929: Nicotinamidase (EC 3.5.1.19)
 
Lactobacillus johnsonii NCC 533

Gene: LJ1274: Nicotinamidase (EC 3.5.1.19)
 
Lactobacillus plantarum WCFS1

Gene: lp_2612: Nicotinamidase (EC 3.5.1.19)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0149: Nicotinamidase (EC 3.5.1.19)
*
Lactobacillus rhamnosus GG

Site:
position = -41
score = 6.53031
sequence = TTTAAGTAAATTTTACTTTAA

Gene: LGG_02764: Nicotinamidase (EC 3.5.1.19)
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1766: Nicotinamidase (EC 3.5.1.19)
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1

Gene: OEOE_0368: Nicotinamidase (EC 3.5.1.19)
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_1245: Nicotinamidase (EC 3.5.1.19)
Nicotinamidase (EC 3.5.1.19)
pncB
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_2766: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0276: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1391: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
*
Lactobacillus helveticus DPC 4571

Site:
position = -74
score = 5.96768
sequence = TAAAAGTAACTTAGACTTTTA

Gene: lhv_0930: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_2771: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
*
Lactobacillus reuteri JCM 1112

Site:
position = -75
score = 6.05633
sequence = TAAAAGTTAATCATACTTTTA

Gene: LAR_0148: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Lactobacillus rhamnosus GG

Gene: LGG_02765: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1

Gene: OEOE_0890: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Pediococcus pentosaceus ATCC 25745
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
CRON 2.
niaP
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_2277: Niacin transporter NiaP
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -61
score = 5.78327
sequence = TAAAGGTAAAAAATACCTAAA

Gene: lp_2514: Niacin transporter NiaP
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_02281: Niacin transporter NiaP
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1529: Niacin transporter NiaP
 
Lactobacillus salivarius subsp. salivarius UCC118
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -40
score = 6.39555
sequence = TAAAAGTAAAAAATACTTTTA

Gene: LEUM_0911: Niacin transporter NiaP
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0213: Niacin transporter NiaP
Niacin transporter NiaP
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD