Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog XylR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367 11 6
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956 5 3
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 3 2
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
LVIS_2287
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -90
score = 5.12814
sequence = GTTGGTTGCTTTCGACAACTAAT

Gene: LVIS_2287: AraC-type DNA-binding protein
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
AraC-type DNA-binding protein
xynT2
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_2286: Xyloside transporter XynT
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Xyloside transporter XynT
xynB
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_2285: Beta-xylosidase
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Beta-xylosidase
 
CRON 2.
xynB2
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0375: Beta-xylosidase (EC 3.2.1.37)
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -121
score = 5.4642
sequence = GTTTGTTTACTAAATAAACTAAC

Gene: LAF_0405: Beta-xylosidase (EC 3.2.1.37)
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0848: Beta-xylosidase (EC 3.2.1.37)
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Beta-xylosidase (EC 3.2.1.37)
xynT3
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0374: Xyloside transporter XynT
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0406: Xyloside transporter XynT
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Xyloside transporter XynT
 
CRON 3.
xylS
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -150
score = 5.26024
sequence = GTTGGTTTAGTAAACCAATTTAC

Gene: LVIS_0462: Alpha-xylosidase (EC 3.2.1.-)
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1244: Alpha-xylosidase (EC 3.2.1.-)
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -182
score = 5.12047
sequence = GTTTGTTAGTTCTATTTACAAAC

Gene: PEPE_0184: Alpha-xylosidase (EC 3.2.1.-)
Alpha-xylosidase (EC 3.2.1.-)
 
CRON 4.
xynT
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -151
score = 5.26024
sequence = GTAAATTGGTTTACTAAACCAAC

Gene: LVIS_0463: Xyloside transporter XynT
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_1245: Xyloside transporter XynT
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -66
score = 5.12047
sequence = GTTTGTAAATAGAACTAACAAAC

Gene: PEPE_0185: Xyloside transporter XynT
Xyloside transporter XynT
xylR
 
Lactobacillus acidophilus NCFM
*2
Lactobacillus brevis ATCC 367

Site:
position = -154
score = 5.43649
sequence = GTTGGTTGGTTCACTGAACCATG

Gene: LVIS_2109: Xylose repressor XylR, ROK family

Gene: LVIS_0464: Xylose repressor XylR, ROK family
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0400: Xylose repressor XylR, ROK family
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0129: Xylose repressor XylR, ROK family
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0186: Xylose repressor XylR, ROK family
Xylose repressor XylR, ROK family
xylA
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -42
score = 5.71647
sequence = GTTGGTTGTCGCAACGAACTAAC

Gene: LVIS_0183: Xylose isomerase (EC 5.3.1.5)
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -53
score = 5.05479
sequence = GTTAGTTGTTTTAAAAAACCAAT

Gene: LAF_0402: Xylose isomerase (EC 5.3.1.5)
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -59
score = 5.79516
sequence = GTTGGTTGGTGTAACCAACTATG

Gene: LEUM_0130: Xylose isomerase (EC 5.3.1.5)
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0187: Xylose isomerase (EC 5.3.1.5)
Xylose isomerase (EC 5.3.1.5)
xylB
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0184: Xylulose kinase (EC 2.7.1.17)
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956

Gene: LAF_0403: Xylulose kinase (EC 2.7.1.17)
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0131: Xylulose kinase (EC 2.7.1.17)
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745

Gene: PEPE_0188: Xylulose kinase (EC 2.7.1.17)
Xylulose kinase (EC 2.7.1.17)
 
CRON 5.
LVIS_0185
 
Lactobacillus acidophilus NCFM
*
Lactobacillus brevis ATCC 367

Site:
position = -111
score = 5.42824
sequence = CATGGTTGGTTGCGGCAATCAAC

Site:
position = -107
score = 6.08539
sequence = GTTGGTTGCGGCAATCAACCAAC

Gene: LVIS_0185: hypothetical protein
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
hypothetical protein
xylT
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367

Gene: LVIS_0186: D-xylose proton-symporter XylT
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
*
Lactobacillus fermentum IFO 3956

Site:
position = -90
score = 5.23473
sequence = GTTAGTTTTTATCAGCAACTAAC

Gene: LAF_0401: D-xylose proton-symporter XylT
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Site:
position = -87
score = 5.64869
sequence = GTTAGTTGGTTGCGTAAATAAAC

Site:
position = -83
score = 5.68123
sequence = GTTGGTTGCGTAAATAAACTAAC

Gene: LEUM_0128: D-xylose proton-symporter XylT
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
D-xylose proton-symporter XylT
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD