Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NiaR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: NiaR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Niacin
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334 1 1
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1 2 2
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG 1 1
Lactobacillus sakei subsp. sakei 23K 1 1
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
niaR
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0807: NAD biosynthesis transcription regulator, HTH_11 family
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -121
score = 5.79768
sequence = TTTAGATGTCTTGACACCTATG

Gene: lp_2770: NAD biosynthesis transcription regulator, HTH_11 family
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG

Gene: LGG_00791: NAD biosynthesis transcription regulator, HTH_11 family
 
Lactobacillus sakei subsp. sakei 23K

Gene: LSA1530: NAD biosynthesis transcription regulator, HTH_11 family
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -64
score = 5.58601
sequence = AATTAATGTCTTGACACTTGTA

Gene: PEPE_0214: NAD biosynthesis transcription regulator, HTH_11 family
NAD biosynthesis transcription regulator, HTH_11 family
 
CRON 2.
niaP
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
*
Lactobacillus casei ATCC 334

Site:
position = -45
score = 5.00161
sequence = CTAGGGTGTCAAGACACCCTAA

Gene: LSEI_2277: Niacin transporter NiaP
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533
 
Lactobacillus plantarum WCFS1

Gene: lp_2514: Niacin transporter NiaP
 
Lactobacillus reuteri JCM 1112
*
Lactobacillus rhamnosus GG

Site:
position = -51
score = 5.56054
sequence = TTAGGGTGTCAAGACACCTAAT

Gene: LGG_02281: Niacin transporter NiaP
*
Lactobacillus sakei subsp. sakei 23K

Site:
position = -76
score = 5.85793
sequence = TTAAGGTGTGTTGACACCTGTA

Gene: LSA1529: Niacin transporter NiaP
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Gene: LEUM_0911: Niacin transporter NiaP
 
Oenococcus oeni PSU-1
*
Pediococcus pentosaceus ATCC 25745

Site:
position = -112
score = 5.58601
sequence = TACAAGTGTCAAGACATTAATT

Gene: PEPE_0213: Niacin transporter NiaP
Niacin transporter NiaP
 
CRON 3.
pncB
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_2766: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Gene: LBUL_0276: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Lactobacillus fermentum IFO 3956

Gene: LAF_1391: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Lactobacillus helveticus DPC 4571

Gene: lhv_0930: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Lactobacillus johnsonii NCC 533
*
Lactobacillus plantarum WCFS1

Site:
position = -46
score = 5.79768
sequence = CATAGGTGTCAAGACATCTAAA

Gene: lp_2771: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Lactobacillus reuteri JCM 1112

Gene: LAR_0148: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Lactobacillus rhamnosus GG

Gene: LGG_02765: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1

Gene: OEOE_0890: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Pediococcus pentosaceus ATCC 25745
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD