Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Chloroflexia

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Chloroflexi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chloroflexus aggregans DSM 9485 6 4
Chloroflexus sp. Y-400-fl 5 4
Herpetosiphon aurantiacus ATCC 23779 8 4
Roseiflexus castenholzii DSM 13941 7 4
Roseiflexus sp. RS-1 7 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nrtR
*
Chloroflexus aggregans DSM 9485

Site:
position = -47
score = 6.02726
sequence = TTAGTGTATTACTAACACTAA

Gene: Cagg_0305: Nudix-related transcriptional regulator NrtR
*
Chloroflexus sp. Y-400-fl

Site:
position = -47
score = 6.12799
sequence = TTAGTGTATAAATAACACTAA

Gene: Chy400_3450: Nudix-related transcriptional regulator NrtR
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -32
score = 5.95704
sequence = TTTGTGTCATAATAACACTAT

Gene: Haur_4290: Nudix-related transcriptional regulator NrtR
*
Roseiflexus castenholzii DSM 13941

Site:
position = -70
score = 5.70722
sequence = TTATTGTTGTAATGACACTAA

Gene: Rcas_0387: Nudix-related transcriptional regulator NrtR
*
Roseiflexus sp. RS-1

Site:
position = -34
score = 5.53802
sequence = TTATTGTTGCAATGACACTAA

Gene: RoseRS_0145: Nudix-related transcriptional regulator NrtR
Nudix-related transcriptional regulator NrtR
nadE
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_2533: NAD synthetase (EC 6.3.1.5)
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1498: NAD synthetase (EC 6.3.1.5)
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_4289: NAD synthetase (EC 6.3.1.5)
*
Roseiflexus castenholzii DSM 13941

Site:
position = -53
score = 6.08075
sequence = AAAGTGTTATACTAACACTAA

Gene: Rcas_2204: NAD synthetase (EC 6.3.1.5)
*
Roseiflexus sp. RS-1

Site:
position = -59
score = 5.82895
sequence = AAAGTGTTATACTGACACCAA

Gene: RoseRS_2679: NAD synthetase (EC 6.3.1.5)
NAD synthetase (EC 6.3.1.5)
pncA
*
Chloroflexus aggregans DSM 9485

Site:
position = -37
score = 5.68681
sequence = ATAGTGTCAGTTTTACACTAC

Gene: Cagg_0030: Nicotinamidase (EC 3.5.1.19)
*
Chloroflexus sp. Y-400-fl

Site:
position = -37
score = 5.65367
sequence = ATAGTGTCAGTTTTACACCAA

Gene: Chy400_4233: Nicotinamidase (EC 3.5.1.19)
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_4288: Nicotinamidase (EC 3.5.1.19)
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_0388: Nicotinamidase (EC 3.5.1.19)
 
Roseiflexus sp. RS-1

Gene: RoseRS_0144: Nicotinamidase (EC 3.5.1.19)
Nicotinamidase (EC 3.5.1.19)
 
CRON 2.
nadA
*
Chloroflexus aggregans DSM 9485

Site:
position = -35
score = 6.26123
sequence = AAAGTGTAACAATAACACTAA

Site:
position = -90
score = 5.24197
sequence = TTAGTGACCTCTTGACAATAT

Gene: Cagg_1772: Quinolinate synthetase (EC 4.1.99.-)
*
Chloroflexus sp. Y-400-fl

Site:
position = -90
score = 5.24197
sequence = TTAGTGACCTCTTGACAATAT

Site:
position = -36
score = 6.43043
sequence = AAAGTGTAATAATAACACTAA

Gene: Chy400_1521: Quinolinate synthetase (EC 4.1.99.-)
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -110
score = 5.40396
sequence = ATTGTGTTAGAATGACATTAT

Site:
position = -49
score = 6.24625
sequence = ATAGTGTCAAAATGACACTTA

Site:
position = -136
score = 5.53726
sequence = AAATTGTCATCTTGACACTAC

Gene: Haur_1289: Quinolinate synthetase (EC 4.1.99.-)
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_1004: Quinolinate synthetase (EC 4.1.99.-)
 
Roseiflexus sp. RS-1

Gene: RoseRS_0438: Quinolinate synthetase (EC 4.1.99.-)
Quinolinate synthetase (EC 4.1.99.-)
nadB
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_1773: L-aspartate oxidase (EC 1.4.3.16)
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_1522: L-aspartate oxidase (EC 1.4.3.16)
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_2309: L-aspartate oxidase (EC 1.4.3.16)
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_1003: L-aspartate oxidase (EC 1.4.3.16)
 
Roseiflexus sp. RS-1

Gene: RoseRS_0437: L-aspartate oxidase (EC 1.4.3.16)
L-aspartate oxidase (EC 1.4.3.16)
nadC
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_1774: Quinolinate phosphoribosyltransferase (EC 2.4.2.19)
 
Chloroflexus sp. Y-400-fl

Gene: Chy400_0971: Quinolinate phosphoribosyltransferase (EC 2.4.2.19)
 
Herpetosiphon aurantiacus ATCC 23779

Gene: Haur_3382: Quinolinate phosphoribosyltransferase (EC 2.4.2.19)
*
Roseiflexus castenholzii DSM 13941

Site:
position = -65
score = 6.15679
sequence = ATAGAGTAACATTGACACTAA

Site:
position = -11
score = 6.61571
sequence = ATAGTGTAAAAATGACACTAA

Gene: Rcas_1005: Quinolinate phosphoribosyltransferase (EC 2.4.2.19)
*
Roseiflexus sp. RS-1

Site:
position = -11
score = 6.61571
sequence = ATAGTGTAAAAATGACACTAA

Site:
position = -65
score = 6.15679
sequence = ATAGAGTAACATTGACACTAA

Gene: RoseRS_0439: Quinolinate phosphoribosyltransferase (EC 2.4.2.19)
Quinolinate phosphoribosyltransferase (EC 2.4.2.19)
pncB
*
Chloroflexus aggregans DSM 9485

Site:
position = -34
score = 6.10348
sequence = AAAGTGTAATAATTACACTAT

Gene: Cagg_0100: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
*
Chloroflexus sp. Y-400-fl

Site:
position = -35
score = 5.77179
sequence = TTAGTGTATAATTTACACTAT

Gene: Chy400_0205: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -54
score = 5.86403
sequence = TTAGTGTATTATAGACACTAA

Gene: Haur_3381: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
*
Roseiflexus castenholzii DSM 13941

Site:
position = -39
score = 5.84005
sequence = ATAGTGTCAATATCACAATAA

Gene: Rcas_1635: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
*
Roseiflexus sp. RS-1

Site:
position = -41
score = 6.09506
sequence = ATAGTGTCAATATAACAATAA

Gene: RoseRS_1316: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
nadD
 
Chloroflexus aggregans DSM 9485

Gene: Cagg_3085: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Chloroflexus sp. Y-400-fl
*
Herpetosiphon aurantiacus ATCC 23779

Site:
position = -35
score = 5.16465
sequence = TTGGTGTCATATTGACTATTA

Site:
position = -83
score = 5.67702
sequence = TTAGTGTGATATTGACAAAAA

Gene: Haur_2310: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Roseiflexus castenholzii DSM 13941

Gene: Rcas_3366: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Roseiflexus sp. RS-1

Gene: RoseRS_2217: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD